FLT3 directed car cells for immunotherapy
CAR cells targeting FLT3 relevant antigens are described as a new method of cancer treatment. It is proposed that FLT3 CAR cells are safe and effective in patients and can be used to treat human tumors and cancer.
1. A method of treating a FLT3 expressing cancer in a subject in need thereof comprising administering to the subject an effective amount of one or more immune cell selected from the group of a T cell, an NK-cell, or a leukocyte derived from hematopoietic stem cells (HSC) produced in the bone marrow, the immune cell expressing a chimeric antigen receptor (CAR),
wherein the CAR comprises:
(a) an antigen binding domain of a FLT3 antibody or an equivalent thereof, wherein the FLT3 antibody comprises a heavy chain variable region comprising:
a CDHR1 having the amino acid comprising SEQ ID NO: 29 (NYGLH),
a CDHR2 having the amino acid sequence comprising SEQ ID NO: 30 (VIWSGGSTDYNAAFIS), and
a CDHR3 having the amino acid sequence comprising SEQ ID NO: 31 (GGIYYANHYYAMDY),
and a light chain variable region comprising:
a CDLR1 having the amino acid sequence comprising SEQ ID NO: 32 (KSSQSLLNSGNQKNYM),
a CDLR2 having the amino acid sequence comprising SEQ ID NO: 33 (GASTRES), and
a CDLR3 having the amino acid sequence comprising SEQ ID NO: 34 (QNDHSYPLT);
(b) a hinge domain;
(c) a transmembrane domain; and
(d) a CD28 costimulatory domain and/or a 4-1BB costimulatory domain;
(e) an intracellular signaling domain; and
(f) an iCasp suicide switch comprising the amino acid sequence encoded by SEQ. ID NO: 40, and
wherein after administration for treating the cancer, the subject maintains or recovers normal hematopoiesis.
2. The method of claim 1 , wherein the heavy chain variable region comprises
the amino acid sequence encoded by the polynucleotide sequence
SEQ ID NO: 27
(CAGGTGCAGCTGAAGCAGTCAGGACCTGGCCTAGTGCAGCCCTCACAGAG
CCTGTCCATCACCTGCACAGTCTCTGGTTTCTCATTAACTAACTATGGTTT
ACACTGGGTTCGCCAGTCTCCAGGAAAGGGCCTGGAGTGGCTGGGAGTGAT
ATGGAGTGGTGGAAGCACAGACTATAATGCAGCTTTCATATCCAGACTGAG
CATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTTAAAATGAACAGTCT
GCAGGCTGATGACACAGCCATATACTACTGTGCCAGAAAAGGAGGGATCTA
CTATGCTAACCATTACTATGCTATGGACTACTGGGGTCAAGGAACCTCAGT
CACCGTCTCCTCA).
3. The method of claim 1 or claim 2 , wherein the CAR further comprises a linker polypeptide between the heavy chain variable region and the light chain variable region.
4. The method of claim 3 , wherein the linker polypeptide comprises between 1 to 6 repeating units of the amino acid sequence GGGGS (SEQ ID NO: 48).
5. The method of claim 1 , wherein the FLT3 expressing cancer is leukemia.
6. The method of claim 5 , wherein the leukemia is acute myeloid leukemia.
7. The method of claim 1 , wherein the subject is a human patient.
8. The method of claim 1 , wherein the one or more immune cells are NK-cells.
9. The method of claim 1 , wherein the one or more immune cells are allogeneic or autologous to the subject.
10. The method of claim 1 or 2 , wherein the light chain variable region comprises the amino acid sequence encoded by the polynucleotide sequence
SEQ ID NO: 28
(GACATTGTGATGACACAGTCTCCATCCTCCCTGAGTGTGTCAGCAGGAGA
GAAGGTCACTATGAGCTGCAAGTCCAGTCAGAGTCTGTTAAACAGTGGAAA
TCAAAAGAACTATATGGCCTGGTATCAGCAGAAACCAGGGCAGCCTCCTAA
ACTGTTGATCTACGGGGCATCCACTAGGGAATCTGGGGTCCCTGATCGCTT
CACAGGCAGTGGATCTGGAACCGATTTCACTCTTACCATCAGCAGTGTGCA
GGCTGAAGACCTGGCAGTTTATTACTGTCAGAATGATCATAGTTATCCGCT
CACGTTCGGTGCTGGGACCAAGCTGGAGCTGAAACGG).
11. The method of claim 1 , wherein the a heavy chain variable region comprising the amino acid sequence encoded by the polynucleotide sequence SEQ ID NO: 27 and the light chain variable region comprising the amino acid sequence encoded by the polynucleotide sequence SEQ ID NO: 28.
12. The method of claim 11 , wherein the CAR further comprises a linker polypeptide.
13. The method of claim 12 , wherein the linker polypeptide comprises between 1 to 6 repeating units of the amino acid sequence GGGGS (SEQ ID NO: 48).
14. The method of claim 11 , wherein the FLT3 expressing cancer is leukemia.
15. The method of claim 14 , wherein the leukemia is acute myeloid leukemia.
16. The method of claim 11 , wherein the subject is a human patient.
17. The method of claim 11 , wherein the one or more immune cells are NK-cells.
18. The method of claim 11 , wherein the one or more immune cells are allogeneic or autologous to the subject.