Method for correcting a genetic sequence
Methods of gene correction, methods of generating induced pluripotent stem cells (iPSCs), and methods of deriving multi-lineage cell types with therapeutic value. In some embodiments, the gene correction affects the expression and/or function of the functional type VII collagen protein (C7).
1. A method comprising:
introducing into a cell that comprises a genomic sequence in need of editing:
a donor template polynucleotide that comprises a polynucleotide that encodes an edited version of the genomic sequence;
a polynucleotide that encodes a clustered regularly interspaced short palindromic repeat associated (Cas) nuclease or nickase; and
a guide RNA (gRNA), wherein the gRNA comprises at least one of:
(SEQ ID NO: 43)
GTGCTGGGCTTCATAGTTCTTGG,
(SEQ ID NO: 44)
GGAGGCTGCGTGCTGGGGGCAGG,
and
(SEQ ID NO: 45)
GCCTTGGGGTCCAGGGCTTCCGG;
allowing the nuclease or nickase to cut at least one strand of the genomic sequence; and
allowing the edited version of the genomic sequence to replace the genomic sequence in need of editing to produce a cell comprising a donor sequence.
2. The method of claim 1 , wherein the cell that comprises a genomic sequence in need of editing is a fibroblast.
3. The method of claim 1 , wherein the genomic sequence in need of editing encodes a portion of the type VII collagen gene (COL7A1).
4. The method of claim 1 , wherein the Cas nuclease or nickase comprises at least a portion of Cas9.
5. The method of claim 1 , wherein the donor template polynucleotide comprises a drug resistance gene.
6. The method of claim 1 , the method further comprising:
generating a clone from the cell comprising a donor sequence.
7. The method of claim 1 , the method further comprising:
reprogramming a cell comprising a donor sequence to obtain an induced pluripotent stem cell (iPSC).
8. The method of claim 7 , wherein reprogramming the cell comprises Sendai virus-based reprogramming.
9. The method of claim 7 , the method further comprising differentiation of the iPSC to form an iPSC-derived cell.
10. The method of claim 9 , wherein differentiation of the iPSC comprises differentiation to at least one of a keratinocyte, a mesenchymal stem cell (MSCs), or a hematopoietic progenitor cell.
11. The method of claim 9 , the method comprising two-dimensional culture of an iPSC in media comprising at least one of retinoic acid and bone morphogenic protein 4 (BMP-4).
12. The method of claim 9 , the method comprising exposing an iPSC to media comprising at least one of platelet-derived growth factor (PDGF)-AB, basic fibroblast growth factor (bFGF), and epidermal growth factor (EGF).
13. The method of claim 9 , the method comprising exposing an iPSC to media comprising a Rho-associated protein kinase (ROCK) inhibitor.
14. The method of claim 9 , the method comprising embryoid body (EB) formation.
15. The method of claim 14 , wherein EB formation comprises exposing an iPSC to a serum free media.
16. The method of claim 14 , the method comprising inhibiting at least one of Activin/Nodal and GS3Kβ.
17. The method of claim 14 , the method comprising co-culture with vascular stroma.
18. The method of claim 1 , the method further comprising isolating the cell that comprises a genomic sequence in need of editing from a subject prior to introducing into the cell the donor template polynucleotide, the polynucleotide that encodes a Cas nuclease or nickase, and the gRNA.
19. The method of claim 1 , the method further comprising introducing the cell comprising a donor sequence or an iPSC-derived cell comprising a donor sequence into a subject.
20. The method of claim 19 , wherein the donor sequence of the cell comprising the donor sequence or the donor sequence of an iPSC-derived cell comprising the donor sequence is free of marker genes.