Methods for detecting
The present disclosure provides methods for determining whether a patient exhibiting pertussis-like symptoms will benefit from treatment, with therapeutic agents that inhibit Bordetella holmesii . These methods are based on detecting Bordetella pertussis, Bordetella parapertussis , and Bordetella holmesii in a biological sample by assaying for the presence of the IS481, IS 1001, and hIS1001 target repeat elements, respectively. Kits for use in practicing the methods are also provided.
1. A method for detecting the presence of at least one pathogenic Bordetella species in an unprocessed biological sample comprising:
(a) contacting the biological sample with:
i. a first primer pair that amplifies an IS481 target nucleic acid consisting of SEQ ID NO: 1 or a complement thereof wherein the first primer consists of a first forward primer consisting of 5′ CCATAAGCATGCCCGATT 3′ (SEQ ID NO: 11) and a first reverse primer consisting of 5′ CGCTTCAGGCACACAAACT 3′ (SEQ ID NO: 10);
ii. a second primer pair that amplifies an IS1001 target nucleic acid consisting of SEQ ID NO: 2 or a complement thereof wherein the second primer consists of a second forward primer consisting of 5′ CGGCTCGACGAATTGC 3′ (SEQ ID NO: 7) and a second reverse primer consisting of 5′ AGTTCGTCACGCAGGACAT 3′ (SEQ ID NO: 8); and
iii a third primer pair that amplifies a hIS1001 target nucleic acid consisting of SEQ ID NO: 3 or a complement thereof, wherein the third primer pair consists of a third forward primer consisting of 5′ GGCACGGATCGAGGTTTTT 3′ (SEQ ID NO: 4) and a third reverse primer consisting of 5′ TACGGCCGTGAAGTGATAGA 3′ (SEQ ID NO: 5);
to produce a reaction-sample mixture under conditions where amplification of the IS481, IS1001, and hIS1001 target nucleic acids occurs if present in the biological sample, wherein the biological sample is not processed prior to amplification, and wherein the biological sample is a nasopharyngeal (NP) aspirate or wash, or a nasopharyngeal swab;
(b) subjecting the reaction-sample mixture to real-time multiplex PCR conditions under which each of the target nucleic acids present in the biological sample is amplified to produce a fluorescent signal;
(c) detecting the fluorescent signal generated by each amplified target nucleic acid produced in step (b); and
(d) detecting the presence of at least one pathogenic Bordetella species in the biological sample by evaluating the fluorescent signal of each target nucleic acid, whereby
i. B. holmesii is detected in the biological sample when a fluorescent signal is detected for the hIS1001 target nucleic acid;
ii. B. parapertussis is detected in the biological sample when a fluorescent signal is detected for the IS1001 target nucleic acid; and
iii. B. pertussis is detected in the biological sample when a fluorescent signal is detected for the IS481 target nucleic acid and no fluorescent signal is detected for the hIS1001 target nucleic acid;
wherein the pathogenic Bordetella species is one or more of B. pertussis, B. parapertussis , and B. holmesii.
2. The method of claim 1 , further comprising contacting the biological sample with
(i) a first nucleic acid probe that is capable of specifically hybridizing to a segment of the IS481 target nucleic acid of SEQ ID NO: 1, wherein the first nucleic acid probe is detectably labeled and comprises 5′ TCAATTGCTGGACCATTTCGAGTCGAC 3′ (SEQ ID NO: 12), optionally wherein the first nucleic acid probe is detectably labelled with a FAM fluorophore,
(ii) a second nucleic acid probe that is capable of specifically hybridizing to a segment of the complement of the IS1001 target nucleic acid of SEQ ID NO: 2, wherein the second nucleic acid probe is detectably labeled and comprises 5′ CAACCAGCCGCTGCTGACGGTC 3′ (SEQ ID NO: 9), optionally wherein the second nucleic acid probe is detectably labelled with a CFR610 fluorophore; and
(iii) a third nucleic acid probe that is capable of specifically hybridizing to a segment of the hIS1001 target nucleic acid of SEQ ID NO: 3, wherein the third nucleic acid probe is detectably labeled and comprises 5′ AGTCGCTGGCTACTGCTGCGCA 3′ (SEQ ID NO: 6), optionally wherein the third nucleic acid probe is detectably labelled with a JOE fluorophore.
3. The method of claim 1 , further comprising contacting the biological sample with a fourth primer pair that amplifies a control target nucleic acid of SEQ ID NO: 20, optionally wherein the fourth primer pair consists of a fourth forward primer comprising 5′ GCTTCAGTACCTTCGGCTTG 3′ (SEQ ID NO: 17) and a fourth reverse primer comprising 5′ TTGCAGGCATCTCTGACAAC 3′ (SEQ ID NO: 18); and/or
further comprising contacting the biological sample with a fourth nucleic acid probe, wherein the fourth nucleic acid probe is detectably labeled and comprises 5′ TGGCTCTTGGCGGTCCAGATG 3′ (SEQ ID NO: 19), optionally wherein the fourth nucleic acid probe is detectably labelled with the Q670 fluorophore.
4. The method of claim 1 , wherein real-time PCR amplification is performed in a direct amplification disc in concert with an integrated thermal cycler.
5. The method of claim 1 , wherein the biological sample is a nasopharyngeal swab.