Method of treating insulin resistance
A method of treating hyperglycemia, diabetes, metabolic syndrome, insulin resistance (insulin insensitivity), impaired glucose tolerance, high glucose levels, pulmonary hypertension, and/or a condition arising from any of the foregoing in a patient is provided. The method comprises knocking down mARC2 or mARC1 expression in the patient, or otherwise decreasing mARC2 and mARC1 activity in the patient.
1. A method of treating hyperglycemia, diabetes, metabolic syndrome, insulin resistance (insulin insensitivity), impaired glucose tolerance, high glucose levels, and/or pulmonary hypertension in a patient in need thereof, comprising knocking down expression of mARC2 in a patient, thereby treating hyperglycemia, diabetes, metabolic syndrome, insulin resistance (insulin insensitivity), impaired glucose tolerance, high glucose levels, and/or pulmonary hypertension in the patient.
2. The method of claim 1 , comprising treating hyperglycemia in the patient by knocking down expression of mARC2 in the patient, thereby reducing plasma glucose levels in the patient.
3. The method of claim 1 , wherein mARC2 mRNA levels are reduced in a cell of the patient.
4. The method of claim 1 , wherein the mARC2 mRNA levels are reduced by administration of a RNAi agent to the patient.
5. The method of claim 4 , wherein the RNAi agent is an siRNA.
6. The method of claim 5 , wherein the siRNA specifically hybridizes to the nucleic acid of SEQ ID NO: 1.
7. The method of claim 5 , wherein the siRNA specifically hybridizes between bases 559-1332 of SEQ ID NO: 1.
8. The method of claim 5 , wherein the siRNA ranges from 21-23 bases in length and comprises or consists of a sequence GTGCTCATCTCCATCATTTAT (SEQ ID NO: 5), GATGAACTCCTAATTGGTAGT (SEQ ID NO: 6), GAACTCCTAATTGGTAGTGTA (SEQ ID NO: 7), GAGGGATTGACTGAGATCTTA (SEQ ID NO: 8), ACAACAGCAGCAACGATACAT (SEQ ID NO: 9), or GATGTGCAGGACGCATGTTAC (SEQ ID NO: 10).
9. The method of claim 1 , wherein an antisense reagent, a ribozyme, or an anti-mARC2 binding agent is administered to the patient to reduce glucose levels in the patient.
10. A method of treating hyperglycemia, diabetes, metabolic syndrome, insulin resistance (insulin insensitivity), impaired glucose tolerance, high glucose levels, and/or pulmonary hypertension in a patient in need thereof, comprising knocking down expression of mARC1 in a patient, thereby treating hyperglycemia, diabetes, metabolic syndrome, insulin resistance (insulin insensitivity), impaired glucose tolerance, high glucose levels, and/or pulmonary hypertension in the patient.
11. The method of claim 10 , comprising treating hyperglycemia in the patient by knocking down expression of mARC1 in the patient, thereby reducing plasma glucose levels in the patient.
12. The method of claim 10 , wherein mARC1 mRNA levels are reduced in a cell of the patient.
13. The method of claim 10 , wherein the mARC1 mRNA levels are reduced by administration of an RNAi agent to the patient.
14. The method of claim 13 , wherein the RNAi agent is an siRNA.
15. The method of claim 14 , wherein the siRNA specifically hybridizes to the nucleic acid of SEQ ID NO: 2.
16. The method of claim 14 , wherein the siRNA specifically hybridizes between bases 309-1135 of SEQ ID NO: 2.
17. The method of claim 14 , wherein the siRNA ranges from 21-23 bases in length and comprises or consists of a sequence GGACCTACTACTGCCTATCAA (SEQ ID NO: 11), GAAGAGTTATCGCCAGTGTGA (SEQ ID NO: 12), GACCCTTCAGAACGAAAGTTA (SEQ ID NO: 13), GGTGTCTCAATGCTTCAATGT (SEQ ID NO: 14), GGCTGGAAGAATATCCTAGAA (SEQ ID NO: 15), or GTGATTTCAGATAGACTACTG (SEQ ID NO: 16).
18. The method of claim 10 , wherein an antisense reagent, a ribozyme, or an anti-mARC1 binding agent is administered to the patient to reduce glucose levels in the patient.