Compositions and methods for suppressing MSUT2
Described herein are compositions and methods for treating Alzheimer's disease or dementia. The compositions include mammalian suppressor of taupathy 2 inhibitors (MSUT2). The MSUT2 inhibitors can be small interfering RNAs, guide RNAs, or small molecules. The methods include reducing accumulation of phosphorylated and aggregated human tau.
1. A method of inhibiting expression of a MSUT2 polynucleotide in a subject in need thereof, the method comprising administering to the subject a mammalian suppressor of tauopathy 2 (MSUT2) inhibitor, wherein the MSUT2 inhibitor is a double stranded small interfering RNA (siRNA) consisting of first and second strands, wherein the first strand comprises AUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 10), AUGAUGCAAAGUGUACUAAACCAGAUU (SEQ ID NO: 11), AUGAUGCAAAGUGUACUAAACCAGAU (SEQ ID NO: 12), AUGAUGCAAAGUGUACUAAACCA (SEQ ID NO: 13), AUAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 14), or UAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 15) and the second strand is sufficiently complementary to the first strand and to MSUT2 mRNA to mediate RNA interference of MSUT2, and wherein the MSUT2 inhibitor is administered intravenously or intrathecally.
2. A method of reducing phosphorylated and aggregated human tau protein in a subject in need thereof, the method comprising administering to the subject a mammalian suppressor of tauopathy 2 (MSUT2) inhibitor, wherein the MSUT2 inhibitor is a double stranded small interfering RNA (siRNA) consisting of first and second strands, wherein the first strand comprises AUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 10), AUGAUGCAAAGUGUACUAAACCAGAUU (SEQ ID NO: 11), AUGAUGCAAAGUGUACUAAACCAGAU (SEQ ID NO: 12), AUGAUGCAAAGUGUACUAAACCA (SEQ ID NO: 13), AUAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 14), or UAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 15) and the second strand is sufficiently complementary to the first strand and to MSUT2 mRNA to mediate RNA interference of MSUT2, and wherein the MSUT2 inhibitor is administered intravenously or intrathecally.
3. A method of potentiating a neuroinflammatory response to a pathological tau protein in a subject in need thereof, the method comprising administering to the subject a mammalian suppressor of tauopathy 2 (MSUT2) inhibitor, wherein the MSUT2 inhibitor is a double stranded small interfering RNA (siRNA) consisting of first and second strands, wherein the first strand comprises AUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 10), AUGAUGCAAAGUGUACUAAACCAGAUU (SEQ ID NO: 11), AUGAUGCAAAGUGUACUAAACCAGAU (SEQ ID NO: 12), AUGAUGCAAAGUGUACUAAACCA (SEQ ID NO: 13), AUAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 14), or UAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 15) and the second strand is sufficiently complementary to the first strand and to MSUT2 mRNA to mediate RNA interference of MSUT2, and wherein the MSUT2 inhibitor is administered intravenously or intrathecally.
4. A method of decreasing astrocytosis or microgliosis in a subject in need thereof, the method comprising administering to the subject a mammalian suppressor of tauopathy 2 (MSUT2) inhibitor, wherein the MSUT2 inhibitor is a double stranded small interfering RNA (siRNA) consisting of first and second strands, wherein the first strand comprises AUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 10), AUGAUGCAAAGUGUACUAAACCAGAUU (SEQ ID NO: 11), AUGAUGCAAAGUGUACUAAACCAGAU (SEQ ID NO: 12), AUGAUGCAAAGUGUACUAAACCA (SEQ ID NO: 13), AUAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 14), or UAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 15) and the second strand is sufficiently complementary to the first strand and to MSUT2 mRNA to mediate RNA interference of MSUT2, and wherein the MSUT2 inhibitor is administered intravenously or intrathecally.
5. A method of reducing neuroinflammation in a subject in need thereof, the method comprising administering to the subject a mammalian suppressor of tauopathy 2 (MSUT2) inhibitor, wherein the MSUT2 inhibitor is a double stranded small interfering RNA (siRNA) consisting of first and second strands, wherein the first strand comprises AUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 10), AUGAUGCAAAGUGUACUAAACCAGAUU (SEQ ID NO: 11), AUGAUGCAAAGUGUACUAAACCAGAU (SEQ ID NO: 12), AUGAUGCAAAGUGUACUAAACCA (SEQ ID NO: 13), AUAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 14), or UAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 15) and the second strand is sufficiently complementary to the first strand and to MSUT2 mRNA to mediate RNA interference of MSUT2, and wherein the MSUT2 inhibitor is administered intravenously or intrathecally.