Methods of diagnosis and treatment of Alzheimer's Disease
Provided are methods of mitigating, reversing or eliminating in a subject one or more symptoms associated with cognitive impairment associated with amyloid deposits in the brain (e.g., olfactory dysfunction as a risk factor of dementia, mild cognitive impairment, Alzheimer's Disease) by detecting and targeting gram negative bacteria in the brain.
1. A method of determining whether gram-negative bacteria molecules are co-localized with amyloid plaques in a subject exhibiting one or more symptoms associated with cognitive impairment associated with amyloid deposits in the brain, comprising determining in a central nervous system (CNS) sample from the subject the presence of gram-negative bacteria; and positively identifying the presence of gram-negative bacteria in the sample as indicative of gram-negative bacteria molecules co-localized with amyloid plaques in the subject, wherein positively identifying the presence of gram-negative bacteria in the sample comprises detecting the presence of E. coli K99 pili protein and the level of E. coli K99 pili protein is significantly greater in the sample from the subject exhibiting one or more symptoms associated with cognitive impairment associated with amyloid deposits in the brain than in a control CNS sample.
2. The method of claim 1 , further comprising determining the presence of one or more gram-negative bacteria biomarkers selected from the group consisting of Gram-negative lipopolysaccharide (LPS), E. coli J5 LPS, Gram-negative GrpE, Gram-negative CAT (Chloramphenicol Acetyltransferase), Gram-negative TetR (Tet Repressor Protein), Gram-negative ALK (Alkaline Phosphatase), and Gram-negative β gal (β-Galactosidase) in the samples.
3. The method of claim 2 , wherein the level of Gram-negative lipopolysaccharide (LPS) is greater in the CNS sample from the subject exhibiting one or more symptoms associated with cognitive impairment associated with amyloid deposits in the brain than in the control CNS sample.
4. The method of claim 2 , wherein the gram-negative LPS co-localizes with Aβ1-40/42 in amyloid deposits and around blood vessels in the CNS sample from the subject.
5. The method of claim 1 , wherein the presence of one or more gram-negative bacteria are identified by detecting in the sample from the subject an approximately 500 bp PCR product of bacterial galactose-1-phosphate uridylyltransferase (GalT)—UDP-galactose-4-epimerase (GalE)—molybdate ABC transporter ATP-binding protein (modF) DNA amplified using forward primer (5′→3′) CAGAATCCATTGCCCGGTGA and reverse sequence (5′→3′) CCATGTCACACTTTTCGCATCT.
6. The method of claim 1 , wherein the gram-negative bacteria are E. coli.
7. The method of claim 1 , wherein the subject has mild cognitive impairment.
8. The method of claim 1 , wherein the subject has Alzheimer's Disease.
9. The method of claim 1 , wherein the subject is human.
10. The method of claim 1 , wherein the subject is at risk of developing Alzheimer's disease.
11. The method of claim 1 , wherein the subject exhibits or has exhibited olfactory impairment in an olfactory challenge test.
12. The method of claim 1 , wherein the subject has a familial risk for having Alzheimer's disease.
13. The method of claim 1 , wherein the subject has a familial Alzheimer's disease (FAD) mutation.
14. The method of claim 1 , wherein the subject is free of and does not have genetic risk factors of Parkinson's disease or schizophrenia.
15. The method of claim 1 , wherein the subject is not diagnosed as having or at risk for Parkinson's disease or schizophrenia.
16. The method of claim 1 , wherein the subject does not have a neurological disease or disorder other than Alzheimer's disease.
17. The method of claim 1 , wherein the subject is not diagnosed as having or at risk for a neurological disease or disorder other than Alzheimer's disease.
18. The method of claim 1 , wherein the CNS samples are cerebral spinal fluid (CSF) samples.
19. The method of claim 1 , wherein the CNS samples are brain tissue samples.
20. The method of claim 19 , wherein the brain tissue samples are superior temporal gyrus gray matter (GM) samples and/or frontal lobe white matter (WM) samples.
21. The method of claim 19 , wherein the E. coli K99 pili protein co-localizes to neuron-like cells in the brain tissue sample from the subject exhibiting one or more symptoms associated with cognitive impairment associated with amyloid deposits in the brain.