RNA-guided human genome engineering
A method of altering a eukaryotic cell is provided including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
1. A method of altering a eukaryotic cell comprising
providing the eukaryotic cell with a guide RNA having a spacer sequence complementary to genomic DNA of the eukaryotic cell and a scaffold sequence,
providing the eukaryotic cell with a Cas enzyme of a Type II CRISPR system that interacts with the guide RNA and cleaves the genomic DNA in a site specific manner,
wherein the guide RNA binds to complementary genomic DNA and the Cas enzyme of a Type II CRISPR system cleaves the genomic DNA in a site specific manner, and wherein the guide RNA is a crRNA-tracrRNA fusion transcript of between 100 nucleotides and 250 nucleotides.
2. The method of claim 1 wherein the eukaryotic cell is provided with the guide RNA by introducing into the eukaryotic cell a nucleic acid encoding the guide RNA and wherein the eukaryotic cell is provided with the Cas enzyme of a Type II CRISPR system by introducing into the eukaryotic cell a nucleic acid encoding the Cas enzyme of a Type II CRISPR system.
3. The method of claim 2 wherein the nucleic acid encoding the guide RNA or the nucleic acid encoding the Cas enzyme of a Type II CRISPR system is introduced into the cell using a viral delivery method.
4. The method of claim 2 wherein the nucleic acid encoding the guide RNA or the nucleic acid encoding the Cas enzyme of a Type II CRISPR system is introduced into the cell using an adeno-associated virus.
5. The method of claim 1 wherein the eukaryotic cell is a yeast cell, a plant cell or a mammalian cell.
6. The method of claim 1 wherein the eukaryotic cell is a human cell.
7. The method of claim 1 wherein the eukaryotic cell is a stem cell.
8. The method of claim 1 wherein the eukaryotic cell is human induced pluripotent stem cell.
9. The method of claim 1 comprising altering the eukaryotic cell at a plurality of genomic DNA sites comprising
providing the eukaryotic cell with a plurality of guide RNAs, each guide RNA having a spacer sequence complementary to a different site on genomic DNA of the eukaryotic cell and a scaffold sequence, and each guide RNA of the plurality being a crRNA-tracrRNA fusion transcript of between 100 nucleotides and 250 nucleotides,
wherein the guide RNAs bind to complementary genomic DNA and the Cas enzyme of a Type II CRISPR system cleaves the genomic DNA in a site specific manner.
10. The method of claim 9 wherein the eukaryotic cell is provided with the plurality of guide RNAs by introducing into the eukaryotic cell a plurality of nucleic acids encoding the guide RNAs.
11. The method of claim 1 wherein the crRNA-tracrRNA fusion transcript includes a secondary structure comprising a first hairpin connected to the spacer sequence and a second 3′ hairpin.
12. The method of claim 1 wherein the guide RNA is expressed by the eukaryotic cell using a human U6 polymerase III promoter.
13. The method of claim 1 wherein the Cas enzyme cleaves the target nucleic acid sequence and a nucleotide is deleted or inserted.
14. The method of claim 1 wherein the Cas enzyme includes a nuclear localization signal.
15. The method of claim 1 wherein the Cas enzyme includes a C-terminus nuclear localization signal.
16. The method of claim 1 wherein the Cas enzyme includes a C-terminus SV40 nuclear localization signal.
17. The method of claim 1 wherein the Cas enzyme cleaves the target nucleic acid sequence thereby altering expression of the target nucleic acid sequence.
18. The method of claim 1 wherein the Cas enzyme cleaves the target nucleic acid sequence resulting in nonhomologous end joining.
19. The method of claim 1 further comprising providing the eukaryotic cell with a donor nucleic acid, and
wherein the Cas enzyme cleaves the target nucleic acid sequence, and
wherein the donor nucleic acid sequence is integrated into the target nucleic acid sequence.
20. The method of claim 1 wherein the scaffold sequence comprises
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:46).
21. The method of claim 1 wherein the scaffold sequence comprises
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:45).
22. The method of claim 1 wherein the Cas enzyme of a Type II CRISPR system is Cas9.
23. A method of altering a eukaryotic cell comprising
providing the eukaryotic cell with a guide RNA having a spacer sequence complementary to genomic DNA of the eukaryotic cell and a scaffold sequence,
providing the eukaryotic cell with a Cas enzyme of a Type II CRISPR system that interacts with the guide RNA and cleaves the genomic DNA in a site specific manner,
wherein the guide RNA binds to complementary genomic DNA and the Cas enzyme of a Type II CRISPR system cleaves the genomic DNA in a site specific manner, and wherein the guide RNA is a crRNA-tracrRNA fusion transcript comprising 100 nucleotides.
24. The method of claim 23 wherein the Cas enzyme of a Type II CRISPR system is Cas9.
25. A method of altering a eukaryotic cell comprising
providing the eukaryotic cell with a guide RNA having a spacer sequence complementary to genomic DNA of the eukaryotic cell and a scaffold sequence,
providing the eukaryotic cell with a Cas9 enzyme that interacts with the guide RNA and cleaves the genomic DNA in a site specific manner,
wherein the guide RNA binds to complementary genomic DNA and the Cas9 enzyme cleaves the genomic DNA in a site specific manner, and wherein the scaffold sequence comprises
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:46).
26. A method of altering a eukaryotic cell comprising
providing the eukaryotic cell with a guide RNA having a spacer sequence complementary to genomic DNA of the eukaryotic cell and a scaffold sequence,
providing the eukaryotic cell with a Cas9 enzyme that interacts with the guide RNA and cleaves the genomic DNA in a site specific manner,
wherein the guide RNA binds to complementary genomic DNA and the Cas9 enzyme cleaves the genomic DNA in a site specific manner, and wherein the scaffold sequence comprises
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC UUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:45).