IP Library Patent Application 16400250
Patent Application
App. No. 16/400,250

Multiple Specific/Nonspecific Primers for PCR of a Complex Gene Pool

Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US None
App. No.
16/400,250
Abstract

Disclosed are compositions and methods for single-step PCR of a sample containing a complex target gene pool that can simultaneously amplify a wide variety of variant target gene sequences common to the sample while maintaining the original ratios of gene variants. The compositions and methods described herein utilize (1) a gene-specific primer pool that contains multiple variants that occur in a sample containing a complex mixture of target sequences that are both required for amplification of variants in the mixture which may introduce amplification bias, with ( 2 ) a non-specific PCR primer that is designed to target multiple gene-specific primer variants and eliminate amplification bias.

Claims (19)

1 . A multi-primer assay for determining ratios of target DNA sequences in a sample, comprising:

(a) contacting the sample with a plurality of oligonucleotide primers in a single vessel, wherein the plurality of oligonucleotide primers comprises:

(i) one or more sets of forward and reverse specific primers having a nonspecific nucleotide sequence designed to not anneal to a DNA sequence in the sample, linked to specific nucleotide sequences complementary to specific consecutive base sequences of target DNA sequences; and

(ii) one or more sets of forward and reverse nonspecific primers having a nucleotide sequence complementary to the nonspecific nucleotide sequence in (i);

(b) performing a minimum of three rounds of a multi-primer amplification reaction in the vessel, wherein the sets of nonspecific primers do not participate in the amplification reaction until round three of the amplification reaction; and

(c) detecting the presence of amplification products corresponding to the target DNA sequences, wherein the ratios of the amplification products reflects the ratio of the target DNA sequences in the sample.

2 . The assay of claim 1 , wherein the one or more sets of forward and reverse specific primers further comprise a linker sequence between the nonspecific nucleotide sequence and the specific nucleotide sequence.

3 . The assay of claim 2 , wherein the linker sequence has a length of from about 5 to about 25 nucleotides.

4 . The assay of claim 3 , wherein the linker sequence comprises a unique DNA bar code sequence to identify the sample.

5 . The assay of claim 1 , wherein the target sequence comprises a sequence of a gene selected from the group consisting of: 16S rRNA, 23S rRNA, 18S rRNA, ITS1, ITS2, HSP65, rpoB, recA, Internally Transcribed Spacer (ITS), human HLA, microbial toxin producing genes, microbial pathogenicity genes, microbial plasmid genes, human immune system genes, immune system components, ribosomal RNA genes, and other variable genetic regions of non-human organisms.

6 . The assay of claim 5 , wherein the 16S rRNA target sequence comprises a region selected from the group consisting of: V1V3, V3V4, V4-V5 and V1V9.

7 . The assay of claim 1 , wherein the target sequence comprises a region V1V9-EXT consisting of part or all of the V1V9 region of a 16S rRNA gene and part or all of the adjacent (i) Internally Transcribed Spacer gene, and (ii) 23S gene.

8 . The assay of claim 1 , wherein the forward specific primers have a nucleotide sequence of AATGATACGGCGACCACCGAGATCTACACATATGCGCACACTCTTTCCCTACACGAC GCTCTTCCGATCTAGRGTTYGATYCTGGCTYAG (SEQ ID NO: 1) wherein Y is C or T, and R is A or G.

9 . The assay of claim 1 , wherein the reverse specific primers have a nucleotide sequence of CAAGCAGAAGACGGCATACGAGATCTGATCGTGTGACTGGAGTTCAGACGTGTGCT CTTCCGATCTTYACCGCRRCTGCTGGCAC (SEQ ID NO: 2) wherein Y is C or T, and R is A or G.

10 . The assay of claim 1 , wherein the forward nonspecific primer has a nucleotide sequence of AATGATACGGCGACCACCGAGATCTACACATATGCGCACACTCTTTCCCTACACGA (SEQ ID NO: 3).

11 . The assay of claim 1 , wherein the reverse nonspecific primer has a nucleotide sequence of CAAGCAGAAGACGGCATACGAGATCTGATCGTGTGACTGGAGTTCAGACGTGTGCT CTTC (SEQ ID NO: 4).

12 . The assay of claim 1 , wherein the target DNA in the sample originates from a source selected from the group consisting of: feces, cell lysate, tissue, blood, tumor, tongue, tooth, buccal swab, phlegm, mucous, wound swab, skin swab, vaginal swab, or any other biological material, tissue or fluid originally obtained from a human, animal, plant, or environmental sample, including raw samples, complex samples, mixtures, and microbiome samples.

13 . The assay of claim 1 , wherein the target DNA originates from an organism selected from the group consisting of: spores, biofilms, multicellular organisms, unicellular organisms, prokaryotes, eukaryotes, microbes, bacteria, archaea, protozoa, algae, fungi and viruses.

14 . A nucleic acid amplification primer represented by the following general formula: 5′-A-B-C-3′ wherein, A represents a nonspecific nucleotide sequence having a length of from about 15 to about 100 nucleotides, that does not anneal to a target nucleic acid, B represents a linker nucleotide sequence having a length of from about 5 to about 30 nucleotides, and C represents a nucleotide sequence complementary to a specific consecutive base sequence of a template nucleic acid having a length of from about 10 to about 30 nucleotides.

Assignments (1)
SECURITY INTEREST Recorded Feb 2, 2022
From: SHORELINE BIOME, LLC
To: DENSLOW, PAUL; JARVIE, THOMAS P; CONNECTICUT INNOVATIONS, INCORPORATED; VC23 INVESTORS LLC
Reel/Frame 058859/0950 →