Antisense targeting dynamin 2 and use for the treatment of centronuclear myopathies and neuropathies
The present invention concerns the use of antisense oligonucleotides (AON) capable of inhibiting expression of dynamin 2, advantageously human dynamin 2, for use in the treatment of Charcot-Marie-Tooth disease (CMT) and centronuclear myopathies (CNM).
1. A method of treating Charcot-Marie-Tooth disease (CMT), comprising administering an antisense oligonucleotide (AON) capable of inhibiting expression of dynamin 2 to a subject in need thereof, wherein the AON:
comprises a nucleic acid sequence TCAGGCCGCCCCATTTTACCTGTTT (SEQ ID NO: 3) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 3; or
targets the region containing 100 nucleotides upstream of the ATG; or
comprises a nucleic acid sequence CTGGACCATCCTATGAGGAAAAGGA (SEQ ID NO: 1) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 1; or
enables skipping of exon 6 on the dynamin 2 pre-mRNA.
2. The method according to claim 1 , wherein the CMT is dominant intermediate CMT (DI-CMTB), axonal CMT (CMT2M), dominant intermediate CMT 1 (CMTDI1), dominant intermediate CMT B (CMTDIB), or CMT type 4B (CMT4B).
3. The method according to claim 1 , wherein the AON targets a junction
between exon 6 and intron 6 on the dynamin 2 pre-mRNA enabling skipping of exon 6 on the dynamin 2 pre-mRNA.
4. The method according to claim 1 , wherein the AON comprises a nucleic acid sequence GACCCTCAACGACCTGGCCCC (SEQ ID NO: 4) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 4.
5. The method according to claim 1 , wherein the AON comprises a nucleic acid sequence CGTGCAAACCCTTGCAGTACCTGAT (SEQ ID NO: 2) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 2.
6. An antisense oligonucleotide (AON), capable of inhibiting expression of dynamin 2, wherein the AON:
comprises a nucleic acid sequence TCAGGCCGCCCCATTTTACCTGTTT (SEQ ID NO: 3) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 3; or
targets the region containing 100 nucleotides upstream of the ATG; or
comprises a nucleic acid sequence CTGGACCATCCTATGAGGAAAAGGA (SEQ ID NO: 1) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 1; or
enables skipping of exon 6 on the dynamin 2 pre-mRNA;
wherein the AON is in the form of a morpholino oligonucleotide.
7. The antisense oligonucleotide according to claim 6 wherein the AON comprises a nucleic acid sequence GACCCTCAACGACCTGGCCCC (SEQ ID NO: 4) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 4.
8. The antisense oligonucleotide according to claim 6 wherein the AON targets the junction between exon 6 and intron 6 on the dynamin 2 pre-mRNA.
9. The antisense oligonucleotide according to claim 6 wherein the AON comprises a nucleic acid sequence CGTGCAAACCCTTGCAGTACCTGAT (SEQ ID NO: 2) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 2.
10. A method of treating a centronuclear myopathy (CNM) comprising administering an antisense oligonucleotide (AON) to a subject in need thereof, wherein the AON:
comprises a nucleic acid sequence TCAGGCCGCCCCATTTTACCTGTTT (SEQ ID NO: 3) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 3; or
targets the region containing 100 nucleotides upstream of the ATG; or
comprises a nucleic acid sequence CTGGACCATCCTATGAGGAAAAGGA (SEQ ID NO: 1) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 1; or
enables skipping of exon 6 on the dynamin 2 pre-mRNA.
11. A viral vector containing an antisense oligonucleotide (AON), wherein the AON:
comprises a nucleic acid sequence TCAGGCCGCCCCATTTTACCTGTTT (SEQ ID NO: 3) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 3; or
targets the region containing 100 nucleotides upstream of the ATG; or
comprises a nucleic acid sequence CTGGACCATCCTATGAGGAAAAGGA (SEQ ID NO: 1) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 1; or
enables skipping of exon 6 on the dynamin 2 pre-mRNA.
12. A pharmaceutical composition comprising the antisense oligonucleotide according to claim 6 or the viral vector of claim 11 .
13. The method according to claim 1 , further comprising administering myotubularin.
14. A kit comprising the antisense oligonucleotide according to claim 6 or the viral vector of claim 11 and instructions for their use.