Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
Some aspects of this disclosure provide compositions, methods, systems, and kits for controlling the activity and/or improving the specificity of RNA-programmable proteins, such as Cas9. For example, provided are guide RNAs (gRNAs) that are engineered to exist in an “on” or “off” state, which control the binding and, in certain instances, cleavage activity of RNA-programmable proteins (e.g., RNA-programmable endonucleases). By incorporating ligand-responsive self-cleaving catalytic RNAs (aptazymes) into guide RNAs, a set of aptazyme-embedded guide RNAs was developed that enable small molecule-controlled nuclease-mediated genome editing and small molecule-controlled base editing, as well as small molecule-dependent transcriptional activation in mammalian cells.
1. A ribonucleic acid (RNA) comprising
(i) a guide RNA;
(ii) a blocking sequence that hybridizes to a portion of the guide RNA; and
(iii) an aptazyme, wherein the aptazyme is integrated between the blocking sequence and the guide RNA, wherein the nucleotide sequence of the blocking sequence and the nucleotide sequence of the aptazyme do not overlap.
2. The RNA of claim 1 , wherein the aptazyme comprises a ligand-responsive riboswitch.
3. The RNA of claim 2 , wherein the ligand-responsive riboswitch is responsive to a ligand selected from the group consisting of small molecules, metabolites, carbohydrates, peptides, proteins, nucleic acids, or nucleotides.
4. The RNA of claim 3 , wherein the riboswitch is a guanine riboswitch, and wherein the ligand is guanine.
5. The RNA of claim 1 , wherein the aptazyme is a guanine-dependent hammerhead aptazyme.
6. The RNA of claim 5 , wherein the guanine aptazyme comprises a nucleic acid sequence that is at least 85% identical to 5′-GUACAUCCAGCUGAUGAGUCCCAAAUAGGACGAAAUACUAUAAUCGCGUGGAUAUG GCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGACUAGUGUCCUGGAUUCCAC-3′ (SEQ ID NO: 62).
7. The RNA of claim 6 , wherein the guanine aptazyme comprises the nucleic acid sequence 5′-GUACAUCCAGCUGAUGAGUCCCAAAUAGGACGAAAUACUAUAAUCGCGUGGAUAUG GCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGACUAGUGUCCUGGAUUCCAC-3′ (SEQ ID NO: 62).
8. The RNA of claim 5 , wherein the blocking sequence hybridizes to the guide RNA when the guanine aptazyme is not bound by guanine, and wherein the blocking sequence does not hybridize to the guide RNA after the aptazyme self-cleaves after the guanine aptazyme binds to guanine.
9. The RNA of claim 1 , wherein the guide RNA comprises a spacer sequence that has at least 10 contiguous nucleotides that are complementary to a target nucleic acid.
10. The RNA of claim 9 , wherein the target nucleic acid is in the genome of an organism.
11. The RNA of claim 1 , wherein the aptazyme is a theophylline-dependent hammerhead aptazyme.
12. The RNA of claim 11 , wherein the theophylline-dependent hammerhead aptazyme comprises a nucleic acid sequence that is at least 85% identical to 5′-GGUACAUCCAGCUGAUGAGUCCCAAAUAGGACGAAAUACAUACCAGCCGAAAGGCC CUUGGCAGGUGUCCUGGAUUCCAC-3′ (SEQ ID NO: 61).
13. The RNA of claim 12 , wherein the theophylline-dependent hammerhead aptazyme comprises the nucleic acid sequence 5′-GGUACAUCCAGCUGAUGAGUCCCAAAUAGGACGAAAUACAUACCAGCCGAAAGGCC CUUGGCAGGUGUCCUGGAUUCCAC-3′ (SEQ ID NO: 61).
14. The RNA of claim 11 , wherein the blocking sequence hybridizes to the guide RNA when the theophylline-dependent hammerhead aptazyme is not bound by theophylline, and wherein the blocking sequence does not hybridize to the guide RNA after the aptazyme self-cleaves after the theophylline-dependent hammerhead aptazyme binds to theophylline.
15. A nucleic acid molecule encoding the RNA of claim 1 .
16. A vector comprising the nucleic acid molecule of claim 15 .
17. An isolated cell comprising the nucleic acid molecule of claim 15 .
18. An isolated cell comprising the RNA of claim 1 .
19. A pharmaceutical composition comprising:
(i) the RNA of claim 1 ; and
(ii) a pharmaceutically acceptable excipient.
20. A kit comprising the RNA of claim 1 .