Granted Patent B2

US 12,264,323 · App. 16/718,155 · Granted Apr 1, 2025

Inventors: John G. Doench (Cambridge, MA); Ruth Hanna (Cambridge, MA)

Assignee: THE BROAD INSTITUTE, INC.

C12N15/86C12N9/22C12N9/96C12N2310/20C12N2750/14143

Abstract

Claims (78)

1. An engineered polynucleotide comprising:

a multiplexed guide sequence cassette comprising a nucleotide sequence encoding two or more Cas12a guide sequences and two or more Cas12a direct repeat (DR) sequences, wherein each guide sequence has a Cas12a DR sequence 5′ of the guide sequence, wherein each Cas12a DR sequence is different, wherein at least one Cas12a DR sequence comprises a mutated Cas12a DR sequence relative to a wildtype Cas12a DR sequence, wherein the wildtype Cas12a DR sequence is TAATTTCTACTCTTGTAGAT (SEQ ID NO: 25), wherein the at least one mutated Cas12a DR sequence comprises a mutation at position 1, 6, 9, 12, 14, 16, 19, or any combination thereof, relative to SEQ ID NO: 25, wherein each mutated Cas12a DR sequence comprises at least one of:

(i) A or G at position 1;

(ii) A, G, or T at position 12;

(iii) A, G, or C at position 14;

(iv) C at position 6 and G at position 19; and

(v) C at position 9 and G at position 16, and

wherein the multiplexed guide sequence cassette is capable of directing equal or greater multiplexing activity of a Cas12a protein, a homologue thereof, or an orthologue thereof, to one or more target polynucleotides that the two or more Cas12a guide sequences target, as compared to a control multiplexed guide sequence cassette comprising only the wildtype Cas12a DR sequence.

2. The engineered polynucleotide of claim 1 , wherein the two or more guide sequences are capable of hybridizing with different target sequences.

3. The engineered polynucleotide of claim 1 , wherein the two or more guide sequences target a sequence in a eukaryotic cell.

4. The engineered polynucleotide of claim 1 , wherein the Cas12a protein is an Acidaminococcus Cas12a (AsCas12a) protein comprising a polypeptide having a sequence that is 80-100% identical to SEQ ID NO: 34, or

wherein the Cas12a protein is an enhanced AsCas12a (EnCas12a) protein comprising an AsCas12a polypeptide comprising E174R, S542R, and a K548R mutations or mutations homologous thereto relative to a wildtype AsCas12a having a polypeptide sequence that is 100% identical to SEQ ID NO: 34; or

wherein the Cas12a protein is a Cas12a protein comprising a polypeptide that is 80% to 100% identical to any one of SEQ ID NOS: 28-33 and 35-51.

5. The engineered polynucleotide of claim 1 , wherein the multiplexed guide sequence cassette comprises 5′ ([Cas12a DR sequence]-[Cas12a guide sequence]) n 3′, wherein n=2-5 and wherein 1, 2, 3, 4, or 5 of the Cas12a DR sequences are independently selected from the mutated Cas12a DR sequences.

6. The engineered polynucleotide of claim 1 , wherein the multiplexed guide sequence cassette comprises 5′ [a first Cas 12a DR sequence]-[a first Cas12a guide sequence]-[a second Cas 12a DR sequence]-[a second Cas12a guide sequence] 3′, wherein the first Cas12a DR sequence and the second Cas12a DR sequence are each independently selected from a Cas12a wildtype DR sequence and the mutated Cas12a DR sequences.

7. The engineered polynucleotide of claim 1 , wherein the at least one mutation is in a loop of the Cas12a DR sequence, wherein the at least one mutation is in a stem loop of the Cas12a DR sequence, or both.

8. The engineered polynucleotide of claim 1 , wherein the at least one mutated Cas12a DR sequence comprises one or more of SEQ ID NOs: 1-21, 23-24, 54-76.

9. The engineered polynucleotide of claim 1 , wherein the at least one mutation comprises at least two, three, or four mutations.

10. The engineered polynucleotide of claim 6 , wherein the first Cas12a guide sequence and the second Cas12a guide sequence each independently targets a target polynucleotide sequence independently selected from a target polynucleotide sequence in Myeloid Cell Leukemia-1 (MCL1) gene, B-Cell Lymphoma 2 (BCL2) Like 1 (BCL2L1) gene, BCL2 gene, BCL2L1-BCL2 gene, Membrane Associated Ring-CH-Type Finger 5 (MARCH5) gene, or WD Repeat and SOCS Box Containing 2 (WSB2) gene.

11. A vector system comprising: one or more vectors, wherein at least one of the one or more vectors comprises the engineered polynucleotide of claim 1 , a polynucleotide encoding a Cas12a polypeptide, or both.

12. The vector system of claim 11 , wherein the vector system comprises one or more plasmids, one or more Adeno-Associated Virus (AAV) vectors, one or more lentiviral vectors, or a combination thereof.

13. The vector system of claim 12 , wherein the one or more AAV vectors is or comprises an AAV vector having a serotype or pseudotype of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV8, AAV9, or any combination thereof.

14. An isolated host cell comprising:

(a) the engineered polynucleotide of claim 1 ;

(b) a vector system comprising one or more vectors, wherein at least of one of the one or more vectors comprises the engineered polynucleotide of claim 1 , a polynucleotide encoding a Cas12a polypeptide, or both, wherein the vector system is capable of expressing the engineered polynucleotide, the Cas12a polypeptide, or both in the isolated host cell;

(c) a Cas12a polypeptide or a polynucleotide encoding a Cas12a polypeptide;

(d) a delivery system comprising any one of (a)-(c) or any combination of (a)-(c); or

(e) any combination of (a)-(d).

15. The cell of claim 14 , wherein the isolated host cell is an isolated eukaryotic host cell.

16. The cell of claim 14 , wherein the isolated host cell is an isolated prokaryotic host cell.

17. A kit comprising:

(a) the engineered polynucleotide of claim 1 ;

(b) a vector system comprising one or more vectors, wherein at least of one of the one or more vectors comprises the engineered polynucleotide of claim 1 , a polynucleotide encoding a Cas12a polypeptide, or both, wherein the vector system is capable of expressing the engineered polynucleotide, the Cas12a polypeptide, or both in an isolated host cell;

(c) a Cas12a polypeptide or a polynucleotide encoding a Cas12a polypeptide;

(d) a delivery system comprising any one of (a)-(c) or any combination of (a)-(c);

(e) a cell comprising any one of (a)-(d) or any combination of (a)-(d); or

(f) any combination of (a)-(e).

18. A delivery system comprising:

(a) the engineered polynucleotide of claim 1 ;

(b) a vector system comprising one or more vectors, wherein at least of one of the one or more vectors comprises the engineered polynucleotide of claim 1 , a polynucleotide encoding a Cas12a polypeptide, or both, wherein the vector system is capable of expressing the engineered polynucleotide, the Cas12a polypeptide, or both in an isolated host cell;

(c) a Cas12a polypeptide or a polynucleotide encoding a Cas12a polypeptide;

(d) one or more particles comprising any one of (a)-(c) or any combination thereof, or

(e) any combination of (a)-(d).

19. The delivery system of claim 18 , wherein the vector system comprises one or more plasmids, one or more lentiviral vectors, one or more Adeno-Associated Virus (AAV) vectors, or a combination thereof.

20. The delivery system of claim 19 , wherein the vector is or comprises an AAV vector, or wherein the vector is or comprises an AAV vector having a serotype or pseudotype of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV8, AAV9, or any combination thereof.

21. The delivery system of claim 18 , wherein the one or more particles is/are lipid-based, comprises a lipid, or is/are or comprises a liposome.

22. The delivery system of claim 18 , wherein the Cas12a polypeptide, when present, is encoded by a single vector or by at least two vectors.

23. The delivery system of claim 22 , wherein the single vector or the at least two vectors are contained in a particle or at least two particles.

24. The delivery system of claim 18 , wherein the Cas12a polypeptide or polynucleotide encoding the Cas12a polypeptide, when present, is contained in one particle or at least two particles.

25. A method of modifying one or more targets in an isolated host cell comprising:

introducing into the isolated host cell

(a) the engineered polynucleotide of claim 1 ;

(b) a vector system comprising one or more vectors, wherein at least of one of the one or more vectors comprises the engineered polynucleotide of claim 1 , a polynucleotide encoding a Cas12a polypeptide, or both, wherein the vector system is capable of expressing the engineered polynucleotide in the isolated host cell;

(c) a Cas12a polypeptide or a polynucleotide encoding a Cas12a polypeptide;

(d) a delivery system comprising any one of (a)-(c) or any combination thereof, or

(e) any combination of (a)-(d).

26. The method of claim 25 , wherein the isolated host cell comprises an isolated eukaryotic host cell.

27. A gene therapy method comprising:

modifying one or more targets in an isolated host cell comprising:

introducing into the isolated host cell

(a) the engineered polynucleotide of claim 1 ;

(b) a vector system comprising one or more vectors, wherein at least of one of the one or more vectors comprises the engineered polynucleotide of claim 1 , a polynucleotide encoding a Cas12a polypeptide, or both, wherein the vector system is capable of expressing the engineered polynucleotide in the isolated host cell;

(c) a Cas12 polypeptide or a polynucleotide encoding a Cas12 polypeptide;

(d) a delivery system comprising any one of (a)-(c) or any combination thereof; or

(e) any combination of (a)-(d).

28. The gene therapy method of claim 27 , wherein the method includes expanding modified isolated host cells, introducing modified isolated host cells into a subject, or both.

29. A method comprising:

modifying a polynucleotide at one or more target regions by contacting the polynucleotide with

(a) the engineered polynucleotide of claim 1 ;

(b) a vector system comprising one or more vectors, wherein at least of one of the one or more vectors comprises the engineered polynucleotide of claim 1 , a polynucleotide encoding a Cas12a polypeptide, or both, wherein the vector system is capable of expressing the engineered polynucleotide;

(c) a Cas12a polypeptide or a polynucleotide encoding a Cas12a polypeptide;

(d) a delivery system comprising any one of (a)-(c) or any combination thereof; or

(e) any combination of (a)-(d); and

performing a functional assay to determine an effect of modifying the polynucleotide.

30. The method of claim 29 , wherein the functional assay is a genotypic assay, a transcriptomic assay, a proteomic assay, an epigenetic assay, a phenotypic assay, or a combination thereof.

31. The method of claim 29 , further comprising exposing the modified polynucleotide to a test molecule, an abiotic condition, or both before performing the functional assay.

32. The method of claim 29 , wherein the method comprises modifying two or more target regions.

33. The method of claim 32 , wherein the two or more target regions are on a same gene.

Assignments (3)

Continuity (3)

References Cited (274)