Granted Patent B2

US 12,227,753 · App. 16/755,534 · Granted Feb 18, 2025

Inventors: Jennifer A. Doudna (Berkeley, CA); David Burstein (Berkeley, CA); Janice S. Chen (Berkeley, CA); Lucas B. Harrington (Berkeley, CA); David Paez-Espino (Walnut Creek, CA); Jillian F. Banfield (Berkeley, CA)

Assignee: The Regents of the University of California

C12N15/85C12N9/22C12N15/113C12N2310/20C12N2800/80

Abstract

Claims (38)

1. A composition comprising an engineered and/or non-naturally occurring complex comprising:

(a) a CasY polypeptide, or a nucleic acid encoding said CasY polypeptide, wherein the CasY polypeptide comprises an amino acid sequence having 97% or more amino acid sequence identity to the amino acid sequence set forth in any one of SEQ ID NOs: 1-2, 4, and 57;

(b) a CasY guide RNA, or a nucleic acid encoding said CasY guide RNA, wherein said CasY guide RNA comprises a guide sequence that is complementary to a target sequence of a target nucleic acid, and comprises a region that can bind to the CasY polypeptide; and

(c) a CasY transactivating noncoding RNA (trancRNA), or a nucleic acid encoding said CasY trancRNA.

2. A kit comprising an engineered and/or non-naturally occurring complex comprising:

(a) a CasY polypeptide, or a nucleic acid encoding said CasY polypeptide, wherein the CasY polypeptide comprises an amino acid sequence having 97% or more amino acid sequence identity to the amino acid sequence set forth in any one of SEQ ID NOs: 1-2, 4, and 57;

(b) a CasY guide RNA, or a nucleic acid encoding said CasY guide RNA, wherein said CasY guide RNA comprises a guide sequence that is complementary to a target sequence of a target nucleic acid, and comprises a region that can bind to the CasY polypeptide; and

(c) a CasY transactivating noncoding RNA (trancRNA), or a nucleic acid encoding said CasY trancRNA.

3. The composition of claim 1 , characterized by at least one of:

(a) the nucleic acid encoding said CasY polypeptide comprises a nucleotide sequence that: (i) encodes the CasY polypeptide and, (ii) is operably linked to a heterologous promoter;

(b) the nucleic acid encoding said CasY guide RNA comprises a nucleotide sequence that: (i) encodes the CasY guide RNA and, (ii) is operably linked to a heterologous promoter; and

(c) the nucleic acid encoding said CasY trancRNA comprises a nucleotide sequence that: (i) encodes the CasY trancRNA and, (ii) is operably linked to a heterologous promoter.

4. The composition of claim 1 , wherein at least one of: the nucleic acid encoding said CasY polypeptide, the nucleic acid encoding said CasY guide RNA, and the nucleic acid encoding said CasY trancRNA, is a recombinant expression vector.

5. The composition of claim 1 , wherein the CasY guide RNA and/or the CasY trancRNA comprises one or more of: a modified nucleobase, a modified backbone, a non-natural internucleoside linkage, a modified sugar moiety, a Locked Nucleic Acid, a Peptide Nucleic Acid, and a deoxyribonucleotide.

6. The composition of claim 1 , wherein the CasY polypeptide is a variant CasY polypeptide with reduced nuclease activity compared to a corresponding wild type CasY protein.

7. The composition of claim 1 , wherein at least one of: the CasY polypeptide, the nucleic acid encoding the CasY polypeptide, the CasY guide RNA, the nucleic acid encoding the CasY guide RNA, the CasY trancRNA, and the nucleic acid encoding the CasY trancRNA; is conjugated to a heterologous moiety.

8. The composition of claim 7 , wherein the heterologous moiety is a heterologous polypeptide.

9. The composition of claim 1 , wherein the CasY polypeptide has reduced nuclease activity compared to a corresponding wild type CasY protein, and is fused to a heterologous polypeptide.

10. The composition of claim 1 , wherein the CasY polypeptide is fused to a heterologous polypeptide that: (i) has DNA modifying activity, (ii) exhibits the ability to increase or decrease transcription, and/or (iii) has enzymatic activity that modifies a polypeptide associated with DNA.

11. The composition of claim 1 , wherein the CasY polypeptide comprises an amino acid sequence having 99% or more amino acid sequence identity to the amino acid sequence set forth in any one of SEQ ID NOs: 1-2, 4, and 57.

12. The composition of claim 1 , wherein the CasY polypeptide comprises the amino acid sequence set forth in any one of SEQ ID NOs: 1-2, 4, and 57.

13. The composition of claim 1 , wherein the trancRNA comprises a nucleotide sequence having 70% or more identity with:

(i)

(SEQ ID NO: 18)

CUCCGAAAGUAUCAAAAUAAAAAGGGUUUCCAGUUUUUAACUAAACUUUA

GCCUUCCACCCUUUCCUGAUUUUGUU;

(ii)

(SEQ ID NO: 18)

ACCUGCCAAAAUUUCGUUCAACGAAACUUAAGCAGGCAAGAAAAUUUAAA

AUUAAAUCCGCUGGUGGGCGGAUAAAGUC;

or

(iii)

(SEQ ID NO: 19)

GGUAUUUCCGGACAGCGGCUUGACCGCAUCGUCCUCGCCUUUUCCUAAAA

U.

14. The composition of claim 1 , wherein the CasY polypeptide is fused to a heterologous polypeptide that is a histone modifier.

15. The composition of claim 1 , wherein the CasY polypeptide is fused to a heterologous polypeptide that is a transcriptional activator or a transcription repressor.

16. The composition of claim 1 , wherein the trancRNA comprises a nucleotide sequence having 70% or more identity with SEQ ID NO: 151.

Assignments (2)

Continuity (2)

References Cited (260)