IP Library Granted Patent US 10,947,595
Granted Patent B2
US 10,947,595 · App. 16/943,870 · Granted Mar 16, 2021

Nucleic acids and methods for detecting chromosomal abnormalities

Inventors: Tobias Mann (Ann Arbor, MI); Heng Wang (Walnut Creek, CA); Jung H. Kim (Northville, MI); Matthew Sekedat (Ann Arbor, MI)
Assignee: Progenity, Inc.
C12Q1/6883C12Q1/6811C12Q1/6816C12Q1/6827G16B25/00G16B30/00G16H50/20C12Q2600/156C12Q2600/158
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 10,947,595
App. No.
16/943,870
Granted
Mar 16, 2021
Kind
B2
Abstract

Methods and nucleic acid molecules for detecting chromosomal abnormalities such as aneuploidy. Methods for selecting nucleic acid molecules for use in the methods of the disclosure.

Claims (55)

1. A method of characterizing fetal DNA in a maternal blood sample, comprising:

a) obtaining a DNA sample isolated from a maternal blood sample;

b) capturing a plurality of target sequences from target sites in the DNA sample using a population of molecular inversion probes (MIPs), wherein each MIP in the population of MIPs comprises:

i) a pair of targeting polynucleotide arms comprising a first targeting polynucleotide arm and a second targeting polynucleotide arm, wherein the first targeting polynucleotide arm has a different nucleotide sequence than the second targeting polynucleotide arm;

ii) a unique molecular tag; and

iii) a polynucleotide linker

 in a sequence:

the first targeting polynucleotide arm-the unique molecular tag-the polynucleotide linker-the second targeting polynucleotide arm;

wherein the pairs of targeting polynucleotide arms in the population of MIPs are identical, and wherein the first targeting polynucleotide arm and the second targeting polynucleotide arm are substantially complementary to pairs of first and second regions that flank each target sequence in the plurality of target sequences in the DNA sample, and wherein the capturing comprises hybridizing the population of MIPs to the DNA sample to produce hybridized MIPs comprising MIPs, from the population of MIPs, hybridized at first target sites and MIPs, from the population of MIPs, hybridized at second target sites, wherein the first target sites comprise target sequences found on a single chromosome and wherein the second target sites comprise target sequences found on multiple chromosomes;

c) circularizing hybridized MIPs to produce MIP replicons;

d) amplifying MIP replicons obtained in step c) to form MIP amplicons;

e) sequencing MIP amplicons obtained in step d) to produce sequence reads;

f) using the sequence reads to determine a number of first capture events based on the unique molecular tags from the MIPs hybridized at first target sites in step b);

g) using the sequence reads to determine a number of second capture events based on the unique molecular tags from the MIPs hybridized at second target sites in step b);

h) providing first site capture metrics by determining, for each target site of the first target sites, a first site capture metric based at least in part on the number of first capture events determined in step f);

i) identifying a first subset of the first site capture metrics determined in step h) that satisfy at least one criterion;

j) providing second site capture metrics by determining, for each target site of the second target sites, a second site capture metric based at least in part on the number of second capture events determined in step g);

k) identifying a second subset of the second site capture metrics determined in step j) that satisfy the at least one criterion;

l) normalizing a first measure determined from the first subset of first site capture metrics identified in step i) by a second measure determined from the second subset of second site capture metrics identified in step k) to obtain a test ratio; and

m) detecting a difference between the test ratio and a plurality of reference ratios that are computed based on reference DNA samples isolated from reference subjects known to exhibit euploidy or aneuploidy, to characterize the fetal DNA in the maternal blood sample.

2. The method of claim 1 , wherein at least one of the following is satisfied:

(1) the length of the first targeting polynucleotide arm is between 14 and 30 nucleotides,

(2) the length of the second targeting polynucleotide arm is between 14 and 30 nucleotides,

(3) each of the targeting polynucleotide arms has a melting temperature between 45° C. and 80° C., or

(4) each of the targeting polynucleotide arms has a GC content between 30% and 80%, or between 30% and 70%.

3. The method of claim 2 , wherein the first targeting polynucleotide arm comprises the nucleotide sequence of

(SEQ ID NO: 4)

5′-CACTGCACTCCAGCCTGG-3′.

4. The method of claim 2 , wherein the second targeting polynucleotide arm comprises the nucleotide sequence of

(SEQ ID NO: 5)

5′-GAGGCTGAGGCAGGAGAA-3′.

5. The method of claim 1 , wherein the polynucleotide linker is not substantially complementary to any genomic region of the subject, and at least one of the following is satisfied:

(1) the polynucleotide linker has a length of between 20 and 1,000 nucleotides,

(2) the polynucleotide linker has a melting temperature of between 45° C. and 80° C.,

(3) the polynucleotide linker has a GC content between 30% and 80%, or between 30% and 70%, or

(4) the polynucleotide linker comprises at least one of a forward amplification primer and a reverse amplification primer.

6. The method of claim 5 , wherein the polynucleotide linker comprises the nucleotide sequence of

(SEQ ID NO: 3)

5′-CTTCAGCTTCCCGATTACGGGCACGATCCGACGGTAGTGT-3′.

7. The method of claim 1 , wherein the MIPs in the population of MIPs comprise the nucleotide sequence of

(SEQ ID NO: 6)

5′-CACTGCACTCCAGCCTGG(N 1-6 )

CTTCAGCTTCCCGATTACGGGCACGATCCGACGGTAGTGT(N 7-12 )

GAGGCTGAGGCAGGAGAA-3′,

wherein (N 1-6 ) represents the unique molecular tag and (N 7-12 ) is present or absent, and represents another unique molecular tag.

8. The method of claim 1 , wherein the population of MIPs has a concentration between 10 fM and 100 nM.

9. The method of claim 1 , wherein the size of the MIP replicons is between 80-90 nucleotides.

10. The method of claim 1 , wherein the sequencing of step e) has a read depth of between 6-8 million reads.

11. The method of claim 1 , wherein each of the MIPs replicons provided in step c) is produced by:

i) the first and second targeting polynucleotide arms, respectively, hybridizing to the first and second regions of a DNA in the DNA sample, respectively, wherein the first and second regions flank a target sequence; and

ii) after the hybridization, using a ligation/extension mixture to extend and ligate a gap region between the two targeting polynucleotide arms of a MIP in the population of MIPs to form a single-stranded circular MIP replicon.

12. The method of claim 1 , further comprising computing a variability coefficient for a plurality of site capture metrics for a particular site, wherein each site capture metric in the plurality of site capture metrics is evaluated from a DNA sample from a different subject, and wherein the at least one criterion used at steps i) and k) includes a requirement that the variability coefficient for the particular site is below a threshold value.

13. The method of claim 1 , wherein the first measure determined at step l) is a sum of the first subset of site capture metrics and corresponds to a chromosome of interest, and the second measure determined at step l) is a sum of the second subset of site capture metrics and corresponds to chromosomes other than the chromosome of interest.

14. The method of claim 1 , wherein the detecting at step m) comprises performing a statistical test to evaluate whether the test ratio obtained at step l) is statistically different from the plurality of reference ratios.

15. The method of claim 1 , wherein the test ratio and the reference ratios are chromosomal fractions.

Assignments (4)
SECURITY INTEREST Recorded Aug 15, 2025
From: BT BIDCO, INC.
To: GLAS USA LLC
Reel/Frame 072473/0861 →
SECURITY INTEREST Recorded Dec 21, 2023
From: BIORA THERAPEUTICS, INC.
To: GLAS TRUST COMPANY LLC, AS COLLATERAL AGENT
Reel/Frame 066089/0235 →
CHANGE OF NAME Recorded May 16, 2022
From: PROGENITY, INC.
To: BIORA THERAPEUTICS, INC.
Reel/Frame 060072/0817 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Sep 29, 2020
From: MANN, TOBIAS; WANG, HENG; KIM, JUNG H.; SEKEDAT, MATTHEW
To: PROGENITY, INC.
Reel/Frame 053912/0646 →
Continuity (4)
Continuation 16596118 · Oct 8, 2019
Division 15224463 · Jul 29, 2016
Provisional Application 62198654 · Jul 29, 2015
Related Publication 20200354792A1 · Nov 12, 2020