Binding agents to pre-fusion state SARS-CoV-2 spike protein
Disclosed is producing recombinant SARS-CoV-2 spike protein in a pre-fusion state, using furin knock out or knockdown mammalian cells (such as HEK293, CHO or other mammalian cells) and using them to generate antibodies and related binding agents. The antibodies/binding agents can be used in SARS-CoV-2 detection assays or in diagnosis of active or prior infection with SARS-CoV-2; in prophylaxis or as a therapeutic; or for prophylactic or therapeutic use against coronaviruses related to SARS-CoV-2.
1. A method of generating binding agents to coronavirus spike proteins which were generated recombinantly in a pre-fusion state, comprising:
generating host cells which lack the ability to express furin but which express SARS-CoV-2 spike protein using a CRISPR Cas9 transfection protocol having sgRNA scaffolds: GATGCGCACAGCCCACGTGT (SEQ ID NO:19); and ACAGTGTGGCACGGAAGCAT (SEQ ID NO:20);
expressing the SARS-CoV-2 spike protein in said host cells; and
generating binding agents to the SARS-CoV-2 spike protein using the expressed SARS-CoV-2 spike protein for either or both of the following steps:
(i) immunizing a mammal to express antibodies against CoV-2 spike protein and fusing B-cells expressing said antibodies from said mammal with an immortal cell line to generate hybridomas expressing antibodies against CoV-2 spike protein; and
(ii) assaying a pool of compounds and antigens for binding agents to the CoV-2 spike protein.
2. The method of claim 1 wherein binding agents are monoclonal antibodies generated in mice, rat, human, hamster, goat, llama, alpaca or rabbit cells.
3. The method of claim 1 wherein the binding agents are chimeric, humanized or human monoclonal antibodies; Fab, Fab′, F(ab)′2 or Fv fragments; single domain antibodies; helix-stabilized antibodies ; diabodies ; disulfide stabilized antibodies; single-chain antibody molecules; domain antibodies; or bi-specific antibodies.
4. The method of claim 1 wherein the host cells are furin −/− knock out cells.
5. The method of claim 1 wherein the host cells are HEK293 cells.
6. The method of claim 1 wherein the sgRNAs are incorporated into in a vector.
7. The method of claim 3 further including the step of conjugating the binding agents with cytotoxic agents, antibiotics or antiviral drugs.
8. The method of claim 7 wherein the cytotoxic agents, antibiotics or antiviral drugs are known or suspected to inhibit or ameliorate Covid 19 infection.
9. The method of claim 3 further including the step of adding excipients to the binding agents to form a formulation for administration.
10. The method of claim 9 wherein the excipients are pharmaceutically acceptable carriers.
11. The method of claim 9 wherein the excipients are water or Ringer's solution.
12. The method of claim 3 further including the step of adding a lyoprotectant to the binding agents.
13. The method of claim 12 wherein the lyoprotectant is a non-reducing sugar.
14. The method of claim 13 wherein the non-reducing sugar is sucrose or trehalose.