OLIGONUCLEOTIDE CONSTRUCTS AND USES THEREOF

1 . A CpG ODN construct having a formula of:

5′M-L-[CpG ODN]3′, or  Formula (IIa):

5′[CpG ODN]-L-M3′  Formula (IIb):

wherein:

M represents a lipid moiety, preferably the lipid moiety comprises at least one lipid moiety selected from the group consisting of cholesterol, tocopherol, a palmitoyl group, and a stearyl group;

L represents a linker comprising 10-100 atoms selected from the group consisting of carbon, nitrogen, oxygen, hydrogen, sulfur and phosphorus, wherein L is covalently linked to the CpG ODN via a cleavable linkage, preferably via an ester or an amide bond; and

CpG ODN comprises at least one CpG motif having a po internucleotide linkage;

optionally, the CpG ODN construct of Formula (IIa) or (IIb) is further covalently conjugated to a targeting moiety, which is preferably selected from the group consisting of galactose, N-acetylgalactosamine (GalNAc), fucose, mannose, sialic acid, N-acetyl neuraminic acid.

2 . A CpG ODN construct having a structure of:

5′M 1 -Y 1 —(((CH 2 ) 2 O) m —X) n —Y 2 -[CpG ODN]-Y 3 -M 2 3′, or  Formula (IIIa):

5′M 2 -Y 3 -[CpG ODN]-Y 2 —(((CH 2 ) 2 O) m —X) n —Y 1 -M 1 3′  Formula (IIIb):

wherein:

M 1 represents a lipid moiety, preferably the lipid moiety comprises at least one selected from the group consisting of cholesterol, tocopherol, a palmitoyl group, and a stearyl group,

M 2 represents a lipid moiety, a targeting moiety, or is absent,

Y 1 is a bond or a linker, preferably ethylene glycol having the formula ((CH 2 ) 2 O) o , wherein o is 1-15, covalently linked to (((CH 2 ) 2 O) m —X) n via a phosphodiester (po) linkage, a phosphorothioate (ps) linkage or a bond,

X is independently a bond, a po linkage or a ps linkage,

each of Y 2 and Y 3 is independently a cleavable linkage, preferably comprises an ester or an amide bond, more preferably comprises a po linkage or a phosphoramidate linkage, most preferably a po linkage, provided that when M 2 is absent, Y 3 is absent,

CpG ODN comprises at least one CpG motif having a po internucleotide linkage, preferably comprises at least two, three or four CpG motifs each having the po internucleotide linkage;

m is an integer from 1 to 15, and

n is an integer from 1 to 5.

3 . The ODN construct of claim 2 , having a formula of:

5′M-Y 1 —(((CH 2 ) 2 O) m —X) n —Y 2 -[CpG ODN]3′, or  Formula (IVa):

5′[CpG ODN]-Y 2 —(((CH 2 ) 2 O) m —X) n —Y 1 -M3′  Formula (IVb):

wherein:

M represents a lipid moiety, preferably the lipid moiety comprises at least one lipid moiety selected from the group consisting of cholesterol, tocopherol, a palmitoyl group, and a stearyl group,

Y 1 is a bond or a linker, preferably ethylene glycol having the formula ((CH 2 ) 2 O) o , wherein o is 1-15, covalently linked to (((CH 2 ) 2 O) m —X) n via a phosphodiester (po) linkage, a phosphorothioate (ps) linkage or a bond,

X is independently a bond, a phosphodiester (po) linkage or a phosphorothioate (ps) linkage,

Y 2 is a cleavable linkage, preferably comprises an ester or an amide bond, more preferably comprises a po linkage or a phosphoramidate linkage, most preferably a po linkage;

CpG ODN comprises at least one CpG motif having a po internucleotide linkage, preferably comprises at least two, three or four CpG motifs each having the po internucleotide linkage;

m is an integer from 1 to 15, preferably 6; and

n is an integer from 1 to 5, preferably 2;

optionally, the CpG ODN construct of Formula (IVa) or (IVb) is further covalently conjugated to a targeting moiety, which is preferably selected from the group consisting of galactose, N-acetylgalactosamine (GalNAc), fucose, mannose, sialic acid, N-acetyl neuraminic acid.

4 . The ODN construct of claim 3 , having a formula construct selected from the group consisting of:

5′M-po(HEG)po(HEG)po-[CpG ODN]3′;

5′M-ps(HEG)po(HEG)po-[CpG ODN]3′,

5′M-ps(HEG)ps(HEG)po-[CpG ODN]3′,

5′M-po(HEG)ps(HEG)po-[CpG ODN]3′,

5′[CpG ODN]-po(HEG)po(HEG)po-M3′,

5′[CpG ODN]-po(HEG)ps(HEG)po-M3′,

5′[CpG ODN]-po(HEG)ps(HEG)ps-M3′, and

5′[CpG ODN]-po(HEG)po(HEG)ps-M3′,

wherein:

M represents a lipid moiety comprising at least one selected from the group consisting of cholesterol, tocopherol, a palmitoyl group, and a stearyl group;

po represents a phosphodiester linkage;

HEG represents ((CH 2 ) 2 O) 6 ;

ps represents a phosphorothioate linkage; and

CpG ODN comprises at least one CpG motif having a po internucleotide linkage, preferably comprises at least two, three or four CpG motifs each having the po internucleotide linkage,

wherein M is covalently linked to (HEG) directly via a po or ps linkage, or indirectly via a second linker that is linked to (HEG) directly via a po or ps linkage.

5 . The ODN construct of claim 3 , having a formula selected from the group consisting of:

5′Toco-po(HEG)po(HEG)po-[CpG ODN]3′, wherein Toco represents tocopherol,

5′Chol-po(HEG)po(HEG)po-[CpG ODN]3′, wherein Chol represents cholesterol,

5′Palm-po(HEG)po(HEG)po-[CpG ODN]3′, wherein Palm represents a palmitoyl group,

5′[CpG ODN]-po(HEG)ps-Chol3′, wherein Chol represents cholesterol,

5′[CpG ODN]-po(HEG)ps-Toco3′, wherein Toco represents tocopherol, and

5′[CpG ODN]-po(HEG)ps-Palm3′, wherein Palm represents a palmitoyl group,

wherein:

po represents a phosphodiester linkage;

HEG represents ((CH 2 ) 2 O) 6 ;

ps represents a phosphorothioate linkage; and

CpG ODN comprises at least one CpG motif having a po internucleotide linkage, preferably comprises at least two, three or four CpG motifs each having the po internucleotide linkage,

wherein the tocopherol, the cholesterol, or the palmitoyl group is covalently linked to the (HEG) directly via a po or ps linkage, or indirectly via a second linker that is linked to (HEG) directly via a po or ps linkage.

6 . The ODN construct of claim 1 , wherein the CpG ODN has a phosphorothioate (ps) internucleotide linkage.

7 . The ODN construct of claim 1 , wherein two to four of the CpG dinucleotides in the CpG ODN each have a phosphodiester (po) internucleotide linkage.

8 . The ODN construct of claim 1 , wherein the CpG ODN comprises a polynucleotide sequence selected from the group consisting of:

(1)

(SEQ ID NO: 1)

5′ TCGTCGTTTTGTCGTTTTGTCGTT 3′;

(2)

(SEQ ID NO: 2)

5′ GGGGGACGATCGTCGGGGGG 3′;

(3)

(SEQ ID NO: 3)

5′ GGGGTCAACGTTGAGGGGGG 3′;

(4)

(SEQ ID NO: 4)

5′ TCCATGACGTTCCTGACGTT 3′;

(5)

(SEQ ID NO: 5)

5′ TCGTCGTTTTCGGCGCGCGCCG 3′;

(6)

(SEQ ID NO: 6)

5′ TCGTCGTTACGTAACGACGACGTT 3′;

and

(7)

(SEQ ID NO: 7)

5′ TCGTCGTTTTGTCGTTTTGTCGT 3′.

9 . The ODN construct of claim 1 , wherein the CpG ODN comprises a polynucleotide sequence selected from the group consisting of:

(1)

(SEQ ID NO: 8)

5' TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps

TpsTpsTpsGpsTpsCpoGpsTpsT 3';

(2)

(SEQ ID NO: 9)

5' TpsCpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTps

TpsTpsTpsGpsTpsCpsGpsTpsT 3';

(3)

(SEQ ID NO: 10)

5' TpsCpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps

TpsTpsTpsGpsTpsCpsGpsTpsT 3';

(4)

(SEQ ID NO: 11)

5' TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpoGpsTps

TpsTpsTpsGpsTpsCpsGpsTpsT 3';

(5)

(SEQ ID NO: 12)

5' TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps

TpsTpsTpsGpsTpsCpoGpsTpsT 3';

(6)

(SEQ ID NO: 13)

5' TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpoGpsTps

TpsTpsTpsGpsTpsCpoGpsTpsT 3';

(7)

(SEQ ID NO: 14)

5' TpsCpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps

TpsTpsTpsGpsTpsCpoGpsTpsT 3';

(8)

(SEQ ID NO: 15)

5' TpsCpsGpsTpsCpsGpsTpsTpsApsCpsGpsTpsApsApsCps

GpsApsCpsGpsApsCpsGpsTpsT 3';

(9)

(SEQ ID NO: 16)

5' TpsCpsGpsTpsCpoGpsTpsTpsApsCpsGpsTpsApsApsCps

GpsApsCpsGpsApsCpsGpsTpsT 3';

(10)

(SEQ ID NO: 17)

5' TpsCpsGpsTpsCpoGpsTpsTpsApsCpoGpsTpsApsApsCps

GpsApsCpsGpsApsCpsGpsTpsT 3';

(11)

(SEQ ID NO: 18)

5' TpsCpsGpsTpsCpoGpsTpsTpsApsCpoGpsTpsApsApsCpo

GpsApsCpsGpsApsCpsGpsTpsT 3';

(12)

(SEQ ID NO: 19)

5' TpsCpsGpsTpsCpoGpsTpsTpsApsCpoGpsTpsApsApsCpo

GpsApsCpoGpsApsCpsGpsTpsT 3';

(13)

(SEQ ID NO: 20)

5' GpsGpsGpsGpsGpsApsCpoGpsApsTpsCpoGpsTpsCpoGps

GpsGpsGpsGpsG 3';

(14)

(SEQ ID NO: 21)

5' GpsGpsGpsGpsTpsCpsApsApsCpoGpsTpsTpsGpsApsGps

GpsGpsGpsGpsG 3';

(15)

(SEQ ID NO: 22)

5' TpsCpsCpsApsTpsGpsApsCpsGpsTpsTpsCpsCpsTpsGps

ApsCpsGpsTpsT 3';

(16)

(SEQ ID NO: 23)

5' TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsCpsGpsGpsCpsGps

CpsGpsCpsGpsCpsCpsG 3';

(17)

(SEQ ID NO: 24)

5' TpsCpoGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps

TpsTpsTpsGpsTpsCpsGpsT 3';

(18)

(SEQ ID NO: 25)

5' TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTps

TpsTpsTpsGpsTpsCpsGpsT 3';

and

(19)

(SEQ ID NO: 26)

5' TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps

TpsTpsTpsGpsTpsCpsGpsT 3';

wherein:

po represents a phosphodiester internucleotide linkage; and

ps represents a phosphorothioate internucleotide linkage.

10 . The ODN construct of claim 1 , having the structure of:

(1)

(SEQ ID NO: 27)

5′ Toco-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps

TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTpsT 3′;

(2)

(SEQ ID NO: 28)

5′ Toco-po(HEG)po(HEG)po-TpsCpsGpsTpsCpoGpsTpsTps

TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3′;

(3)

(SEQ ID NO: 29)

5′ TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps

TpsTpsTpsGpsTpsCpoGpsTpsT-(HEG)po(HEG)po-Toco 3′;

(4)

(SEQ ID NO: 30)

5′ TpsCpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps

TpsTpsTpsGpsTpsCpsGpsTpsT-(HEG)po(HEG)po-Toco 3′;

(5)

(SEQ ID NO: 31)

5′ Chol-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps

TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTpsT 3′;

(6)

(SEQ ID NO: 32)

5′ Chol-po(HEG)po(HEG)poTpsCpsGpsTpsCpsGpsTpsTps

TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3′;

(7)

(SEQ ID NO: 33)

5′ Chol-po(HEG)po(HEG)po-TpsCpoGpsTpsCpsGpsTpsTps

TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3′;

(8)

(SEQ ID NO: 34)

5′ Chol-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps

TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3′;

(9)

(SEQ ID NO: 35)

5′ Chol-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps

TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3′;

(10)

(SEQ ID NO: 36)

5′ Chol-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps

TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTpsT 3′;

(11)

(SEQ ID NO: 37)

5′ TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps

TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po-

Chol 3′;

(12)

(SEQ ID NO: 38)

5′ TpsCpoGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps

TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po-

Chol 3′;

(13)

(SEQ ID NO: 39)

5′ TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTps

TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po-

Chol 3′;

(14)

(SEQ ID NO: 40)

5′ TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps

TpsTpsTpsGpsTpsCpoGpsTpsTps-(HEG)po(HEG)po-

Chol 3′;

(15)

(SEQ ID NO: 41)

5′ TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps

TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po-

Toco 3′;

(16)

(SEQ ID NO: 42)

5′ Toco-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps

TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTpsT 3′;

(17)

(SEQ ID NO: 43)

5′ TpsCpoGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps

TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po-

Toco 3′;

(18)

(SEQ ID NO: 44)

5′ TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTps

TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po-

Toco 3′;

(19)

(SEQ ID NO: 45)

5′ TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps

TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po-

Toco 3′;

(20)

(SEQ ID NO: 46)

5′ TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps

TpsTpsTpsGpsTpsCpoGpsTpsTps-(HEG)po(HEG)po-

Toco 3′;

(21)

(SEQ ID NO: 47)

5′ Toco-po(HEG)po(HEG)po-TpsCpsGpsTpsCpsGpsTpsTps

TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3′;

(22)

(SEQ ID NO: 48)

5′ Toco-po(HEG)po(HEG)po-TpsCpoGpsTpsCpsGpsTpsTps

TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3′;

(23)

(SEQ ID NO: 49)

5′ Toco-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps

TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3′;

(24)

(SEQ ID NO: 50)

5′ Toco-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps

TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3′;

(25)

(SEQ ID NO: 51)

5′-TpsCpoGpsTpsCGpsTpsTpsTpsTpsGpsTpsCGpsTpsTpsTps

TpsGpsTpsCpoGpsTpsTps-HEGps-Chol 3′;

(26)

(SEQ ID NO: 52)

5′-TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps

TpsTpsTpsGpsTpsCpsGpsTpsTps(HEG)po(HEG)po-Chol 3′;

(27)

(SEQ ID NO: 53)

5′-GpsGpsGpsGpsTpsCpsApsApsCpoGpsTpsTpsGpsApsGps

GpsGpsGpsGpsGps-HEGps-Chol 3′;

(28)

(SEQ ID NO: 54)

5′-TpsCpsCpsApsTpsGpsApsCpsGpsTpsTpsCpsCpsTpsGps

ApsCpsGpsTpsTps-HEGps-Chol 3′;

(29)

(SEQ ID NO: 55)

5′-TpsCpsCpsApsTpsGpsApsCpsGpsTpsTpsCpsCpsTpsGps

ApsCpsGpsTpsTps-HEGps-Toco 3′;

(30)

(SEQ ID NO: 56)

5′ Palmitoyl-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGps

TpsTpsTpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGps

TpsT 3′;

wherein:

Chol represents cholesterol;

Toco represents tocopherol;

Palmitoyl represents a palmitoyl group;

HEG represents ((CH 2 ) 2 O) 6 ;

po represents a phosphodiester linkage; and

ps represents a phosphorothioate linkage,

wherein the tocopherol, the cholesterol, or the palmitoyl group is covalently linked to the (HEG) directly via a po or ps linkage, or indirectly via a second linker that is linked to (HEG) directly via a po or ps linkage.

11 . (canceled)

12 . An ODN construct having a structure of:

or a pharmaceutically acceptable salt thereof, wherein the Oligonucleotides represents a CpG ODN comprising at least one CpG motif having a po internucleotide liknage.

13 . The ODN construct of claim 12 , wherein the CpG ODN contains SEQ ID NO:1.

14 . The ODN construct of claim 13 , wherein the CpG ODN consists of

5′TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTpsT-3′.

15 . The ODN construct of claim 12 , having the following structure:

16 . An ODN construct having a structure of:

17 . A pharmaceutical composition comprising the ODN construct of claim 1 and a pharmaceutically acceptable carrier.

18 . A method of preparing a pharmaceutical composition, comprising combining the ODN construct of claim 1 with a pharmaceutically acceptable carrier.

19 . A method of stimulating an immune response in a subject in need hereof, comprising administering to the subject the pharmaceutical composition of claim 17 .

20 . A method of treating a disease in a subject in need thereof, comprising administering to the subject the pharmaceutical composition of claim 17 , wherein the disease is selected from the group consisting of Hepatitis B virus (HBV) and cancer.

21 . The ODN construct of claim 1 , wherein at least one CpG motif comprises two, three or four CpG motifs each having the po intemucleotide linkage.