Genetic predictors of a response to treatment with CRHR1 antagonists
The present disclosure provides methods for predicting a treatment response of a subject to a treatment with a CRHR1 antagonist and methods of detecting a polymorphism genotype associated with a treatment response of a subject to treatment with a CRHR1 antagonist. Sets of at least one polymorphism genotype useful in such methods are also disclosed. Further, methods of treating a condition which is treatable by a CRHR1 antagonist in a subject in need thereof are provided. Compositions, kits and arrays and uses thereof are also disclosed, which can be used in the methods of the invention.
1 . A method of treatment of a subject comprising:
(a) detecting at least one polymorphism genotype selected from the group consisting of rs11715827 [G], rs2044070 [G], rs2028629 [G] and rs6026567 [G] in a biological sample from the subject;
(b) after step (a), diagnosing the subject as a CRHR1 antagonist responder, or having an increased likelihood of responding to a CRHR1 antagonist; and
(c) administering a CRHR1 antagonist to the subject diagnosed as a CRHR1 antagonist responder.
2 . The method of claim 1 , wherein the diagnosing step comprises one or more statistical analysis method selected from the group consisting of artificial neural network learning, decision tree learning, decision tree forest learning, linear discriminant analysis, non-linear discriminant analysis, genetic expression programming, relevance vector machines, linear models, generalized linear models, generalized estimating equations, generalized linear mixed models, the elastic net, the lasso support vector machine learning, Bayesian network learning, probabilistic neural network learning, clustering, and regression analysis, optionally wherein the statistical analysis method is computer-implemented.
3 . The method of claim 1 , wherein the CRHR1 antagonist responder has a clinical response.
4 . The method of claim 1 , wherein the subject has depressive symptoms, anxiety symptoms or both depressive symptoms and anxiety symptoms or a sleep disorder; and/or
wherein the CRHR1 antagonist treats depressive symptoms, anxiety symptoms or both depressive symptoms and anxiety symptoms or a sleep disorder.
5 . The method of claim 3 , wherein the clinical response is a prevention, alteration, alleviation or complete remission of depressive symptoms and/or anxiety symptoms or a sleep disorder.
6 . The method of claim 3 , wherein the clinical response is a prevention, alteration, alleviation or complete remission of depressive symptoms and/or anxiety symptoms as determined using a scale selected from the group consisting of HAM-D, BDI, MADRS, GDS, ZSRDS, HAM-A and STAI.
7 . The method of claim 1 , wherein the biological sample is a buccal or a blood sample.
8 . The method of claim 1 , wherein detecting comprises the use of one or more polynucleotides capable of specifically hybridizing to at least one nucleic acid comprising the one or more polymorphism genotypes.
9 . The method of claim 1 , wherein the subject diagnosed as a CRHR1 antagonist responder has a sensitivity of higher than 50% and a specificity of higher than 50%.
10 . The method of claim 1 , wherein the CRHR1 antagonist is selected from the group consisting of GW876008 (Emicerfont), GSK-561679 (NBI-77860, Verucerfont), GSK586529, BMS-562,086 (Pexacerfont), NBI-30775 (R-121919), NBI-34101, CP-316,311, CP-376,395, PF-00572778, NVP-AAG561, Ono-2333 MS, E2508, E2009, R317573 (JNJ19567470, CRA5626, TAI-041), R278995 (CRA0450), CRA-1000, CRA-1001, CP154,526, Antalarmin, DMP-695, DMP-696, DMP-904, SC-241, BMS-561388, NBI30545, PD-171729, NBI34041, NBI35965, SN003, NBI-27914, trans-2-chloro-N-(4-((5-fluoro-4-methyl-pyridin-2-ylamino)-methyl)-cyclohexyl)-5-(trifluoromethyl)benzamide, SSR-125543, or a pharmaceutically acceptable salt thereof.
11 . The method of claim 1 , wherein the CRHR1 antagonist is selected from the group consisting of a Type I CRHR1 antagonist, a bicyclic Type II CRHR1 antagonist, an atypical CRHR1 antagonist, and a cyclohexyl amide CRHR1 antagonist.
12 . The method of claim 1 , wherein the subject has a condition selected from the group consisting of depressive symptoms, anxiety symptoms, both depressive symptoms and anxiety symptoms, and a sleep disorder.
13 . A method of treating comprising
(a) detecting at least one polymorphism genotype selected from the group consisting of rs11715827 [G], rs2044070 [G], rs2028629 [G] and rs6026567 [G] in a biological sample from the subject, wherein detecting comprises using a kit comprising:
i) at least one polynucleotide capable of specifically hybridizing to a nucleic acid comprising—at least one polymorphism genotype selected from the group consisting of rs11715827 [G], rs2044070 [G], rs2028629 [G] and rs6026567 [G], and
ii) one or more additional reagents for detecting the presence of the one or more polymorphism genotypes,
(b) diagnosing the subject as a non-peptidic CRHR1 antagonist responder, or having an increased likelihood of responding to a non-peptidic CRHR1 antagonist; and
(c) administering a non-peptidic CRHR1 antagonist to the subject diagnosed as a non-peptidic CRHR1 antagonist responder.
14 . The method of claim 13 , wherein the at least one polynucleotide is bound to a solid support.
15 . The method of claim 13 , wherein the at least one polynucleotide is bound to the solid support in the form of an array.
16 . The method of claim 13 , further comprising one or more reagents for isolating a nucleic acid from a sample.
17 . The method of claim 13 , further comprising a means for amplifying a nucleic acid.
18 . The method of claim 13 , wherein the kit is used to detect the presence or absence of one or more polymorphism genotypes within a sample obtained from a subject.
19 . A method of treating comprising:
(a) detecting at least one polymorphism genotype selected from the group consisting of rs11715827 [G], rs2044070 [G], rs2028629 [G] and rs6026567 [G] in a biological sample;
(b) diagnosing the subject as a non-peptidic CRHR1 antagonist responder, or having an increased likelihood of responding to a non-peptidic CRHR1 antagonist; and
(c) administering a non-peptidic CRHR1 antagonist to the subject diagnosed as a non-peptidic CRHR1 antagonist responder.
20 . The method of claim 19 , wherein the diagnosing step comprises one or more statistical analysis method selected from the group consisting of artificial neural network learning, decision tree learning, decision tree forest learning, linear discriminant analysis, non-linear discriminant analysis, genetic expression programming, relevance vector machines, linear models, generalized linear models, generalized estimating equations, generalized linear mixed models, the elastic net, the lasso support vector machine learning, Bayesian network learning, probabilistic neural network learning, clustering, and regression analysis, optionally wherein the statistical analysis method is computer-implemented.
21 . The method of claim 19 , wherein the non-peptidic CRHR1 antagonist responder has a clinical response.
22 . The method of claim 19 , wherein the subject has depressive symptoms, anxiety symptoms or both depressive symptoms and anxiety symptoms or a sleep disorder; and/or
wherein the CRHR1 antagonist treats depressive symptoms, anxiety symptoms or both depressive symptoms and anxiety symptoms or a sleep disorder.
23 . The method of claim 21 , wherein the clinical response is a prevention, alteration, alleviation or complete remission of depressive symptoms and/or anxiety symptoms or a sleep disorder.
24 . The method of claim 21 , wherein the clinical response is a prevention, alteration, alleviation or complete remission of depressive symptoms and/or anxiety symptoms as determined using a scale selected from the group consisting of HAM-D, BDI, MADRS, GDS, ZSRDS, HAM-A and STAI.
25 . The method of claim 19 , wherein the biological sample is a buccal or a blood sample.
26 . The method of claim 19 , wherein detecting comprises the use of one or more polynucleotides capable of specifically hybridizing to at least one nucleic acid comprising the one or more polymorphism genotypes.
27 . The method of claim 19 , wherein the prediction that the subject will respond to a treatment with a non-peptidic CRHR1 antagonist has a sensitivity of higher than 50% and a specificity of higher than 50%.
28 . The method of claim 19 , wherein the non-peptidic CRHR1 antagonist is selected from the group consisting of GW876008 (Emicerfont), GSK-561679 (NBI-77860, Verucerfont), GSK586529, BMS-562,086 (Pexacerfont), NBI-30775 (R-121919), NBI-34101, CP-316,311, CP-376,395, PF-00572778, NVP-AAG561, Ono-2333 MS, E2508, E2009, R317573 (JNJ19567470, CRA5626, TAI-041), R278995 (CRA0450), CRA-1000, CRA-1001, CP154,526, Antalarmin, DMP-695, DMP-696, DMP-904, SC-241, BMS-561388, NBI30545, PD-171729, NBI34041, NBI35965, SN003, NBI-27914, trans-2-chloro-N-(4-((5-fluoro-4-methyl-pyridin-2-ylamino)-methyl)-cyclohexyl)-5-(trifluoromethyl)benzamide, SSR-125543, or a pharmaceutically acceptable salt thereof.
29 . The method of claim 1 , wherein the detecting step comprises amplification of nucleic acids extracted and/or purified from the biological sample obtained from the subject, and optionally clean-up of amplified products.
30 . The method of claim 29 , further comprising fragmentation of amplified nucleic acids and/or labelling of amplified nucleic acids.
31 . The method of claim 11 , wherein the detecting step comprises amplification of nucleic acids extracted and/or purified from the biological sample obtained from the subject, and optionally clean-up of amplified products.
32 . The method of claim 31 , further comprising fragmentation of amplified nucleic acids and/or labelling of amplified nucleic acids.
33 . The method of claim 13 , wherein the detecting step comprises amplification of nucleic acids extracted and/or purified from the biological sample obtained from the subject, and optionally clean-up of amplified products.
34 . The method of claim 33 , further comprising fragmentation of amplified nucleic acids and/or labelling of amplified nucleic acids.
35 . The method of claim 19 , wherein the detecting step comprises amplification of nucleic acids extracted and/or purified from the biological sample obtained from the subject, and optionally clean-up of amplified products.
36 . The method of claim 35 , further comprising fragmentation of amplified nucleic acids and/or labelling of amplified nucleic acids.
37 . The method of claim 1 , wherein the detecting step comprises specific hybridization of at least one polynucleotide, which is optionally labelled, to a nucleic acid comprising the one or more polymorphism genotypes.
38 . The method of claim 37 , wherein the polynucleotide is a primer or a probe.
39 . The method of claim 37 , wherein the at least one polynucleotide capable of specifically hybridizing to the polymorphism genotypes is selected from the group consisting of
AGAATTATTGCTGCACAATTCTTATGAAACCGAACTAGAGCTACACTATT (SEQ ID NO:179),
AATCTTGGGGAATCTGAGTTTATTAGAGGAATGTAGGGAGGAAGCAGGCT (SEQ ID NO:102),
TACCATGGGAAACAGACAGTGGCCCCTGTTCTCAAGTGGCTTAGACTCTA (SEQ ID NO:208), and
TAAGGATGGGACCCCTACTGTCCATCTCAGGCTCAGCACTGCCTTGGGGC (SEQ ID NO:249).
40 . The method of claim 11 , wherein the detecting step comprises specific hybridization of at least one polynucleotide to a nucleic acid comprising the one or more polymorphism genotypes.
41 . The method of claim 40 , wherein the polynucleotide is a primer or a probe.
42 . The method of claim 40 , wherein the at least one polynucleotide capable of specifically hybridizing to the polymorphism genotypes is selected from the group consisting of
AGAATTATTGCTGCACAATTCTTATGAAACCGAACTAGAGCTACACTATT (SEQ ID NO:179),
AATCTTGGGGAATCTGAGTTTATTAGAGGAATGTAGGGAGGAAGCAGGCT (SEQ ID NO:102),
TACCATGGGAAACAGACAGTGGCCCCTGTTCTCAAGTGGCTTAGACTCTA (SEQ ID NO:208), and
TAAGGATGGGACCCCTACTGTCCATCTCAGGCTCAGCACTGCCTTGGGGC (SEQ ID NO:249).
43 . The method of claim 13 , wherein the detecting step comprises specific hybridization of at least one polynucleotide to a nucleic acid comprising the one or more polymorphism genotypes.
44 . The method of claim 43 , wherein the polynucleotide is a primer or a probe.
45 . The method of claim 43 , wherein the at least one polynucleotide capable of specifically hybridizing to the polymorphism genotypes is selected from the group consisting of
AGAATTATTGCTGCACAATTCTTATGAAACCGAACTAGAGCTACACTATT (SEQ ID NO:179),
AATCTTGGGGAATCTGAGTTTATTAGAGGAATGTAGGGAGGAAGCAGGCT (SEQ ID NO:102),
TACCATGGGAAACAGACAGTGGCCCCTGTTCTCAAGTGGCTTAGACTCTA (SEQ ID NO:208), and
TAAGGATGGGACCCCTACTGTCCATCTCAGGCTCAGCACTGCCTTGGGGC (SEQ ID NO:249).
46 . The method of claim 19 , wherein the detecting step comprises specific hybridization of at least one polynucleotide to a nucleic acid comprising the one or more polymorphism genotypes.
47 . The method of claim 46 , wherein the polynucleotide is a primer or a probe.
48 . The method of claim 46 , wherein the at least one polynucleotide capable of specifically hybridizing to the polymorphism genotypes is selected from the group consisting of
AGAATTATTGCTGCACAATTCTTATGAAACCGAACTAGAGCTACACTATT (SEQ ID NO: 179),
AATCTTGGGGAATCTGAGTTTATTAGAGGAATGTAGGGAGGAAGCAGGCT (SEQ ID NO:102),
TACCATGGGAAACAGACAGTGGCCCCTGTTCTCAAGTGGCTTAGACTCTA (SEQ ID NO:208), and
TAAGGATGGGACCCCTACTGTCCATCTCAGGCTCAGCACTGCCTTGGGGC (SEQ ID NO:249).
49 . The method of claim 1 , wherein the detecting step comprises a method selected from the group consisting of allele-specific oligonucleotide (ASO)-dot blot analysis, primer extension assays, iPLEX polymorphism/SNP genotyping, dynamic allele-specific hybridization (DASH) genotyping, the use of molecular beacons, tetra primer ARMS PCR, a flap endonuclease invader assay, an oligonucleotide ligase assay, PCR-single strand conformation polymorphism (SSCP) analysis, quantitative real-time PCR assay, polymorphism/SNP microarray based analysis, restriction enzyme fragment length polymorphism (RFLP) analysis, targeted resequencing analysis and whole genome sequencing analysis.
50 . The method of claim 11 , wherein the detecting step comprises a method selected from the group consisting of allele-specific oligonucleotide (ASO)-dot blot analysis, primer extension assays, iPLEX polymorphism/SNP genotyping, dynamic allele-specific hybridization (DASH) genotyping, the use of molecular beacons, tetra primer ARMS PCR, a flap endonuclease invader assay, an oligonucleotide ligase assay, PCR-single strand conformation polymorphism (SSCP) analysis, quantitative real-time PCR assay, polymorphism/SNP microarray based analysis, restriction enzyme fragment length polymorphism (RFLP) analysis, targeted resequencing analysis and whole genome sequencing analysis.
51 . The method of claim 13 , wherein the detecting step comprises a method selected from the group consisting of allele-specific oligonucleotide (ASO)-dot blot analysis, primer extension assays, iPLEX polymorphism/SNP genotyping, dynamic allele-specific hybridization (DASH) genotyping, the use of molecular beacons, tetra primer ARMS PCR, a flap endonuclease invader assay, an oligonucleotide ligase assay, PCR-single strand conformation polymorphism (SSCP) analysis, quantitative real-time PCR assay, polymorphism/SNP microarray based analysis, restriction enzyme fragment length polymorphism (RFLP) analysis, targeted resequencing analysis and whole genome sequencing analysis.
52 . The method of claim 19 , wherein the detecting step comprises a method selected from the group consisting of allele-specific oligonucleotide (ASO)-dot blot analysis, primer extension assays, iPLEX polymorphism/SNP genotyping, dynamic allele-specific hybridization (DASH) genotyping, the use of molecular beacons, tetra primer ARMS PCR, a flap endonuclease invader assay, an oligonucleotide ligase assay, PCR-single strand conformation polymorphism (SSCP) analysis, quantitative real-time PCR assay, polymorphism/SNP microarray based analysis, restriction enzyme fragment length polymorphism (RFLP) analysis, targeted resequencing analysis and whole genome sequencing analysis.
53 . The method of claim 1 , wherein the at least one polymorphism genotype comprises at least one polymorphism genotype selected from the group consisting of rs11715827 [G], rs2044070 [G], rs2028629 [G] and rs6026567 [G] in combination with at least one polymorphism genotype selected from the group consisting of rs17740874 [T], rs3811939 [G], rs1882478 [G], rs2235013 [T], rs2214102 [T], rs6415328 [C], rs77152456 [A], rs66794218 [A], rs2589476 [T], rs118003903 [G], rs11871392 [T], rs2589487 [C], rs74338736 [C], rs6026593 [G] and rs6520908 [T].
54 . The method of claim 19 , wherein the one or more polymorphism genotypes comprise at least one polymorphism genotype selected from the group consisting of rs11715827 [G], rs2044070 [G], rs2028629 [G] and rs6026567 [G] in combination with at least one polymorphism genotype selected from the group consisting of rs17740874 [T], rs3811939 [G], rs1882478 [G], rs2235013 [T], rs2214102 [T], rs6415328 [C], rs77152456 [A], rs66794218 [A], rs2589476 [T], rs118003903 [G], rs11871392 [T], rs2589487 [C], rs74338736 [C], rs6026593 [G] and rs6520908 [T].
55 . The method of claim 53 , wherein the at least one polymorphism genotype comprises:
(a) at least two;
(b) at least four;
(c) at least eight;
(d) at least sixteen; or
(e) all
of the polymorphism genotypes as defined in claim 53 .
56 . The method of claim 54 , wherein the one or more polymorphism genotypes comprise:
(a) at least two;
(b) at least four;
(c) at least eight;
(d) at least sixteen; or
(e) all
of the polymorphism genotypes as defined in claim 54 .
57 . The method of claim 13 , wherein the kit comprises at least one polynucleotide capable of specifically hybridizing to a nucleic acid at least one polymorphism genotype selected from the group consisting of rs11715827 [G], rs2044070 [G], rs2028629 [G] and rs6026567 [G] in combination with at least one polynucleotide capable of specifically hybridizing to a nucleic acid at least one polymorphism genotype selected from the group consisting of rs17740874 [T], rs3811939 [G], rs1882478 [G], rs2235013 [T], rs2214102 [T], rs6415328 [C], rs77152456 [A], rs66794218 [A], rs2589476 [T], rs118003903 [G], rs11871392 [T], rs2589487 [C], rs74338736 [C], rs6026593 [G] and rs6520908 [T].
58 . The method of claim 57 , wherein said kit comprises:
(a) at least two;
(b) at least four;
(c) at least eight;
(d) at least 16; or
(e) 19
of the polynucleotides capable of specifically hybridizing to nucleic acids comprising each of the polymorphism genotypes as defined in claim 57 .