IP Library › Granted Patent US 11,898,143
Granted Patent B2
US 11,898,143 · App. 17/153,215 · Granted Feb 13, 2024

Agents useful in treating facioscapulohumeral muscular dystrophy

Inventors: Alexandra Belayew (Tilff, BE); Frederique Coppee (Havre, BE); Celine Vanderplanck (Asquillies, BE); Stephen Donald Wilton (Applecross, AU); Eugenie Ansseau (Dour, BE)
Assignee: Universite de Mons
C12N15/113C12N15/111C12N2310/11C12N2310/14C12N2310/315C12N2310/321C12N2310/3233C12N2310/3513C12N2310/531C12N2320/33
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 11,898,143
App. No.
17/153,215
Granted
Feb 13, 2024
Kind
B2
Abstract

Antisense agents and RNA interference agents useful for treating diseases and conditions the treatment of which can benefit from reducing the expression of double homeobox 4 and/or double homeobox 4c, more particularly facioscapulohumeral muscular dystrophy. Methods, uses and further products employing such agents are also described.

Claims (30)

1. An oligonucleotide of 20 to 30 nucleotides in length that comprises at least 20 consecutive nucleotides that are complementary to the nucleotide sequence set forth as SEQ ID NO: 12 (CTTCCTGGCTAGACCTGCGCGCAGT), wherein the oligonucleotide comprises one or more modifications.

2. The oligonucleotide of claim 1 , wherein the oligonucleotide is perfectly complementary to the nucleotide sequence set forth as SEQ ID NO: 12 (CTTCCTGGCTAGACCTGCGCGCAGT).

3. The oligonucleotide of claim 1 , wherein the oligonucleotide comprises at least 20 consecutive nucleotides of SEQ ID NO: 18 (ACUGCGCGCAGGUCUAGCCAGGAAG).

4. The oligonucleotide of claim 1 , wherein the oligonucleotide comprises at least 20 consecutive nucleotides of SEQ ID NO: 18 (ACUGCGCGCAGGUCUAGCCAGGAAG), wherein one or more uracil bases are replaced by thymine bases.

5. The oligonucleotide of claim 1 , wherein the oligonucleotide comprises the nucleotide sequence set forth as SEQ ID NO: 18 (ACUGCGCGCAGGUCUAGCCAGGAAG), wherein one or more uracil bases are replaced by thymine bases.

6. The oligonucleotide of claim 1 , wherein the oligonucleotide comprises the nucleotide sequence set forth as SEQ ID NO: 18 (ACUGCGCGCAGGUCUAGCCAGGAAG), wherein each uracil bases is replaced by a thymine base.

7. The oligonucleotide of claim 1 , wherein the one or more modifications comprises a phosphorodiamidate morpholino backbone modification.

8. The oligonucleotide of claim 7 , wherein each of the one or more modifications is a phosphorodiamidate morpholino backbone modification.

9. The oligonucleotide of claim 8 , wherein the oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO).

10. The oligonucleotide of claim 1 , wherein the one or more modifications comprises a 2′—O—methoxyethyl sugar modification.

11. The oligonucleotide of claim 10 , wherein each of the one or more modifications is a 2′—O—methoxyethyl sugar modification.

12. The oligonucleotide of claim 1 , wherein the oligonucleotide is conjugated to a moiety that enhances the cellular uptake of the oligonucleotide.

13. The oligonucleotide of claim 12 , wherein the moiety enhances uptake of the oligonucleotide into muscle cells.

14. The oligonucleotide of claim 13 , wherein the moiety is a cell-penetrating peptide.

15. The oligonucleotide of claim 9 , wherein the oligonucleotide is conjugated to a moiety that enhances the cellular uptake of the oligonucleotide.

16. The oligonucleotide of claim 15 , wherein the moiety enhances uptake of the oligonucleotide into muscle cells.

17. A method for reducing the expression of DUX4 in a cell, comprising delivering the oligonucleotide of claim 1 to the cell in an amount effective to reduce expression of DUX4 in the cell.

18. The method of claim 17 , wherein the cell is in vitro.

19. The method of claim 17 , wherein the cell is in a subject.

20. The method of claim 17 , wherein the cell is a muscle cell.

21. The method of claim 20 , wherein the muscle cell is a muscle cell of a subject having facioscapulohumeral muscular dystrophy (FSHD).

22. The method of claim 21 , wherein the subject is a human subject.

23. A method for reducing the expression of DUX4 in a cell, the method comprising delivering the oligonucleotide of claim 9 to the cell in an amount effective to reduce expression of DUX4 in the cell.

24. The method of claim 23 , wherein the cell is in vitro.

25. The method of claim 23 , wherein the cell is in a subject.

26. The method of claim 23 , wherein the cell is a muscle cell.

27. The method of claim 26 , wherein the muscle cell is a muscle cell of a subject having facioscapulohumeral muscular dystrophy (FSHD).

28. The method of claim 27 , wherein the subject is a human subject.

29. The method of claim 23 , wherein the oligonucleotide is conjugated to a moiety that enhances the cellular uptake of the oligonucleotide.

30. The method of claim 29 , wherein the moiety enhances uptake of the oligonucleotide into muscle cells.

Assignments (1)
SECURITY INTEREST Recorded Jun 27, 2025
From: DYNE THERAPEUTICS, INC.
To: HERCULES CAPITAL, INC., AS AGENT
Reel/Frame 071777/0300 →
Priority Claims (1)
EP 10175125 · Sep 2, 2010 · regional
Continuity (6)
Continuation 16562030 · Sep 5, 2019
Continuation 15873751 · Jan 17, 2018
Continuation 15047258 · Feb 18, 2016
Continuation 14078133 · Nov 12, 2013
Division 13225384 · Sep 2, 2011
Related Publication 20210163942A1 · Jun 3, 2021