METHODS AND COMPOSITIONS INVOLVING THERMOSTABLE CAS9 PROTEIN VARIANTS
The disclosure provides Cas9 protein variants that are thermostable at elevated temperatures (e.g., at least 70° C. or above). A Cas9 protein may have at least 75% sequence identity to a wild-type Cas9 protein (e.g., a wild-type Cas9 protein having the sequence of SEQ ID NO:1) and/or one or more amino acid substitutions relative to the wild-type Cas9 protein.
1 . An isolated clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) 9 protein variant comprising the sequence of SEQ ID NO: 1 or an enzymatically active variant or fragment thereof, wherein the enzymatically active variant or fragment has Cas9 nuclease activity at 70° C. or above.
2 . An isolated Cas9 protein variant comprising a sequence having at least 75% sequence identity to the sequence of a wild-type Cas9 protein, wherein the Cas protein variant has at least one amino acid substitution relative to the sequence of the wild-type Cas9 protein, and wherein the wild-type Cas9 protein has a sequence of SEQ ID NO:1.
3 . The isolated Cas9 protein variant of claim 2 , wherein the isolated Cas9 protein variant is a fragment of the wild-type Cas9 protein.
4 . The isolated Cas9 protein variant of any one of claims 1 to 3 , wherein the isolated Cas9 protein variant has nuclease activity at a temperature of between 20° C. and 100° C.
5 . The isolated Cas9 protein variant of any one of claims 1 to 3 , wherein the isolated Cas9 protein variant has nuclease activity at a temperature of at least 70° C.
6 . The isolated Cas9 protein variant of any one of claims 1 to 5 , wherein the isolated Cas9 protein variant forms a ribonucleoprotein complex with a single-guide RNA (sgRNA), wherein the sgRNA comprises a guide sequence and a scaffold sequence.
7 . The isolated Cas9 protein variant of claim 6 , wherein the scaffold sequence has at least 75% sequence identity to the sequence of GUUGUGAUUUGCUUUCAAAGAAAUUUGAAGCAAAUCACAAUAAGGAUUUUUCCGUUGUGAAAACAUU UACAGUAGUCCCGAUGCAAACCAUCGGGAUUGUUGUUUU (SEQ ID NO:7).
8 . The isolated Cas9 protein variant of claim 6 or 7 , wherein the guide sequence has at least 22 nucleotides.
9 . The isolated Cas9 protein variant of any one of claims 6 to 8 , wherein the guide sequence has between 22 and 25 nucleotides.
10 . The isolated Cas9 protein variant of any one of claims 1 to 9 , wherein the isolated Cas9 protein variant recognizes an adenine-rich protospacer adjacent motif (PAM) sequence.
11 . The isolated Cas9 protein variant of claim 10 , wherein the adenine-rich PAM sequence comprises at least 40% adenine in its sequence.
12 . The isolated Cas9 protein variant of claim 10 or 11 , wherein the adenine-rich PAM sequence has at least 70% sequence identity to the sequence of CCACATCGAA (SEQ ID NO:4) or AGACATGAAA (SEQ ID NO:5).
13 . The isolated Cas9 protein variant of any one of claims 1 to 9 , wherein the isolated Cas9 protein variant binds a PAM motif having the sequence of NVRNAT (SEQ ID NO:6), wherein N is any nucleotide, V is A, G or C, and R is G or A.
14 . The isolated Cas9 protein variant of any one of claims 1 to 9 , wherein the isolated Cas9 protein variant binds a PAM motif having the sequence of NRRNAT (SEQ ID NO:13), wherein N is any nucleotide and R is G or A.
15 . The isolated Cas9 protein variant of claim 13 or 14 , wherein the PAM motif has the sequence of GGACAT (SEQ ID NO:10).
16 . A ribonucleoprotein complex comprising:
(1) an isolated Cas9 protein variant comprising a sequence having at least 75% sequence identity to the sequence of a wild-type Cas9 protein, and
(2) an sgRNA comprising a guide sequence and a scaffold sequence,
wherein the scaffold sequence has at least 75% sequence identity to the sequence of SEQ ID NO:7.
17 . The ribonucleoprotein complex of claim 16 , wherein the guide sequence has at least 22 nucleotides.
18 . The ribonucleoprotein complex of claim 17 , wherein the guide sequence has between 22 and 25 nucleotides.
19 . A composition comprising:
(1) a ribonucleoprotein complex comprising:
(a) an isolated Cas9 protein variant comprising a sequence having at least 75% sequence identity to the sequence of a wild-type Cas9 protein, and
(b) an sgRNA comprising a guide sequence and a scaffold sequence, and
(2) a ribosomal complementary DNA (cDNA),
wherein the scaffold sequence has at least 75% sequence identity to the sequence of SEQ ID NO:7.
20 . The ribonucleoprotein complex of claim 19 , wherein the ribosomal cDNA is generated in a polymerase chain reaction (PCR).
21 . The ribonucleoprotein complex of any one of claims 16 to 20 , wherein the isolated Cas9 protein variant comprises at least one amino acid substitution relative to the sequence of the wild-type Cas9 protein.
22 . The ribonucleoprotein complex of any one of claims 16 to 21 , wherein the isolated Cas9 protein variant comprises a fragment of the wild-type Cas9 protein.
23 . The ribonucleoprotein complex of any one of claims 16 to 22 , wherein the wild-type Cas9 protein has the sequence of SEQ ID NO:1.
24 . The ribonucleoprotein complex of any one of claims 16 to 23 , wherein the isolated Cas9 protein variant has nuclease activity at a temperature of between 20° C. and 100° C.
25 . The ribonucleoprotein complex of any one of claims 16 to 23 , wherein the isolated Cas9 protein variant has nuclease activity at a temperature of at least 70° C.
26 . The ribonucleoprotein complex of any one of claims 16 to 25 , wherein the isolated Cas9 protein variant recognizes an adenine-rich protospacer adjacent motif (PAM) sequence.
27 . The ribonucleoprotein complex of claim 26 , wherein the adenine-rich PAM sequence comprises at least 40% adenine in its sequence.
28 . The ribonucleoprotein complex of claim 26 or 27 , wherein the adenine-rich PAM sequence has at least 70% sequence identity to the sequence of CCACATCGAA (SEQ ID NO:4) or AGACATGAAA (SEQ ID NO:5).
29 . The ribonucleoprotein complex of any one of claims 16 to 25 , wherein the isolated Cas9 protein variant recognizes a PAM sequence having the sequence of NVRNAT (SEQ ID NO:6), wherein N is any nucleotide, V is A, G or C, and R is G or A.
30 . The ribonucleoprotein complex of any one of claims 16 to 25 , wherein the isolated Cas9 protein variant recognizes a PAM sequence having the sequence of NRRNAT (SEQ ID NO:13), wherein N is any nucleotide and R is G or A.
31 . A cell comprising the ribonucleoprotein complex of any one of claims 16 to 30 .
32 . A method of altering the genome of a cell, comprising contacting the cell with:
(1) an isolated Cas9 protein variant comprising a sequence having at least 75% sequence identity to the sequence of a wild-type Cas9 protein, and
(2) an sgRNA comprising a guide sequence and a scaffold sequence,
wherein the scaffold sequence has at least 75% sequence identity to the sequence of SEQ ID NO:7,
wherein the isolated Cas9 protein variant interacts with the sgRNA and a target DNA within the cell, and
wherein the guide sequence in the sgRNA comprises a region complementary to a region of the target DNA.
33 . The method of claim 32 , wherein the isolated Cas9 protein variant recognizes an adenine-rich PAM sequence.
34 . The method of claim 33 , wherein the adenine-rich PAM sequence comprises at least 40% adenine in its sequence.
35 . The method of claim 33 or 34 , wherein the adenine-rich PAM sequence has at least 70% sequence identity to the sequence of CCACATCGAA (SEQ ID NO:4) or AGACATGAAA (SEQ ID NO:5).
36 . The method of claim 32 , wherein the isolated Cas9 protein variant recognizes a PAM sequence having the sequence of NVRNAT (SEQ ID NO:6), wherein N is any nucleotide, V is A, G or C, and R is G or A.
37 . The method of claim 32 , wherein the isolated Cas9 protein variant recognizes a PAM sequence having the sequence of NRRNAT (SEQ ID NO:13), wherein N is any nucleotide and R is G or A.