RNA-guided human genome engineering
A method of altering a eukaryotic cell is provided including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
1. An ex vivo eukaryotic stem cell comprising an RNA-guided system for use in the ex vivo eukaryotic stem cell comprising
(1) a guide RNA sequence or a first nucleic acid sequence encoding the guide RNA sequence and
(2) a Cas protein of a Type II CRISPR system that forms a complex with the guide RNA sequence, or a second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system, wherein the Cas protein of a Type II CRISPR system is a Cas nickase of a Type II CRISPR system or a nuclease null Cas of a Type II CRISPR system,
wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript comprising a spacer sequence complementary to a target nucleic acid sequence within the ex vivo eukaryotic stem cell and a scaffold sequence, and wherein the scaffold sequence comprises GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:46).
2. The ex vivo eukaryotic stem cell of claim 1 wherein the Cas nickase is a Cas9 nickase and wherein the nuclease null Cas is a nuclease null Cas9.
3. The ex vivo eukaryotic stem cell of claim 1 wherein the ex vivo eukaryotic stem cell is a yeast cell, a plant cell, a mammalian cell or a human cell.
4. The ex vivo eukaryotic stem cell of claim 1 wherein the ex vivo eukaryotic stem cell is an ex vivo human induced pluripotent stem cell.
5. An ex vivo eukaryotic stem cell comprising an RNA-guided system for use in the ex vivo eukaryotic stem cell comprising
(1) a guide RNA sequence or a first nucleic acid sequence encoding the guide RNA sequence and
(2) a Cas protein of a Type II CRISPR system that forms a complex with the guide RNA sequence, or a second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system, wherein the Cas protein of a Type II CRISPR system is a Cas nickase of a Type II CRISPR system or a nuclease null Cas of a Type II CRISPR system,
wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript comprising a spacer sequence complementary to a target nucleic acid sequence within the ex vivo eukaryotic stem cell and a scaffold sequence, and wherein the scaffold sequence comprises GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:45).
6. The ex vivo eukaryotic stem cell of claim 5 wherein the Cas nickase is a Cas9 nickase and wherein the nuclease null Cas is a nuclease null Cas9.
7. The ex vivo eukaryotic stem cell of claim 5 wherein the ex vivo eukaryotic stem cell is a yeast cell, a plant cell, a mammalian cell or a human cell.
8. The in vivo eukaryotic stem cell of claim 5 wherein the in vivo eukaryotic stem cell is a human induced pluripotent stem cell.
9. The ex vivo eukaryotic stem cell of claim 1 further comprising a regulatory element operable in a eukaryotic cell operably linked to the nucleotide sequence encoding the guide RNA sequence.
10. The ex vivo eukaryotic stem cell of claim 1 further comprising a human U6 polymerase III promoter operably linked to the nucleotide sequence encoding the guide RNA sequence.
11. The ex vivo eukaryotic stem cell of claim 1 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid.
12. The ex vivo eukaryotic stem cell of claim 1 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid including a nuclear localization signal.
13. The ex vivo eukaryotic stem cell of claim 1 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid including a C-terminal nuclear localization signal.
14. The ex vivo eukaryotic stem cell of claim 1 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid including a C-terminal SV40 nuclear localization signal.
15. The ex vivo eukaryotic stem cell of claim 1 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid comprising a regulatory element operable in a eukaryotic cell.
16. The ex vivo eukaryotic stem cell of claim 1 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid comprising a human U6 polymerase III promoter.
17. The ex vivo eukaryotic stem cell of claim 5 further comprising a regulatory element operable in a eukaryotic cell operably linked to the nucleotide sequence encoding the guide RNA sequence.
18. The ex vivo eukaryotic stem cell of claim 5 further comprising a human U6 polymerase III promoter operably linked to the nucleotide sequence encoding the guide RNA sequence.
19. The ex vivo eukaryotic stem cell of claim 5 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid.
20. The ex vivo eukaryotic stem cell of claim 5 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid including a nuclear localization signal.
21. The ex vivo eukaryotic stem cell of claim 5 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid including a C-terminal nuclear localization signal.
22. The ex vivo eukaryotic stem cell of claim 5 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid including a C-terminal SV40 nuclear localization signal.
23. The ex vivo eukaryotic stem cell of claim 5 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid comprising a regulatory element operable in a eukaryotic cell.
24. The ex vivo eukaryotic stem cell of claim 5 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid comprising a human U6 polymerase III promoter.