Method For Determining the Presence of Intestinal Parasites
This invention relates to the field of detection of intestinal parasites from patient, food or environmental samples, preferably from a stool sample. Particularly, the present invention provides a polymerase chain reaction (PCR) based assay method for detection of intestinal parasite infection, particularly the infection of parasite species selected from a group consisting of Hymenolepis nana, Hymenolepis diminuta, Fasciolopsis buski, Encephalitozoon spp. (such as E. intestinalis, E. cuniculi and E. hellem ), Enterocytozoon bieneusi, Enterobius vermicularis, Diphyllobothrium latum, Diphyllobothrium nihonkaiense, Schistosoma mansoni, Blastocystis hominis, Ancylostoma duodenale and liver worms, such as Clonorchis sinensis, Opisthorchis spp., and Metorchis spp. The present invention further provides materials such as primers, primer pairs and probes for use in the method of the invention. Preferably, the method of the invention is a multiplex real-time PCR assay for rapid determination of clinically important intestinal parasites.
1 . A method for detecting the presence or absence of one or more intestinal parasites in a biological sample comprising the steps of:
i) contacting the sample or nucleic acid isolated therefrom with a set of oligonucleotide primers comprising one or more primer pairs that binds to a target sequence selected from SEQ ID NOs: 1-16 and 46-47 and allow amplification of at least part of the target sequence in step ii);
ii) performing a nucleic acid amplification reaction to specifically amplify the target sequences of the intestinal parasite(s) in the sample; and
iii) detecting the presence of an amplified target sequence, wherein the presence of the target sequence is indicative of the presence of one or more intestinal parasites in the sample,
wherein the one or more intestinal parasites is selected from Hymenolepis nana, Hymenolepis diminuta, Fasciolopsis buski, Encephalitozoon spp., Enterocytozoon bieneusi, Enterobius vermicularis, Diphyllobothrium latum, Diphyllobothrium nihonkaiense, Schistosoma mansoni, Blastocystis hominis, Ancylostoma duodenale and liver worms.
2 . The method according to claim 1 , wherein the set of oligonucleotide primers comprises one or more primer pairs selected from of:
a) a primer pair for detecting Hymenolepis nana and Hymenolepis diminuta comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO:17) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGAACACTGCCGTCTTTACATCTAA (SEQ ID NO:18);
b) a primer pair for detecting Hymenolepis nana and Hymenolepis diminuta comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO:17) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AAATACAGCCGTCTTAACATCCAA (SEQ ID NO:19);
c) a primer pair for detecting Fasciolopsis buski comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CACTGTTCAAGTGGTATTGATTG (SEQ ID NO:20) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCAGGTTATCAGTCCTACCC (SEQ ID NO:21);
d) a primer pair for detecting E. intestinalis, E. cuniculi , and E. hellem comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CTGAGTCCTGAGTGTTAGATAAGA (SEQ ID NO:22) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CTAATGCCAATCAATCCCGTG (SEQ ID NO:23);
e) a primer pair for detecting E. intestinalis, E. cuniculi , and E. hellem comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GTCCTTCGTGTTAGATAAGATATAAGTC (SEQ ID NO:24) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGATAATGCCAATCAATCCCATG (SEQ ID NO:25);
f) a primer pair for detecting E. intestinalis, E. cuniculi , and E. hellem comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GACGAAGATTGAGAGGTCTGA (SEQ ID NO:26) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CTAATGCCTATCAATCCCGTG (SEQ ID NO:27);
g) a primer pair for detecting Enterocytozoon bieneusi comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GAGTGTAGTATAGACTGGCGAA (SEQ ID NO:28) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCGTCCTTGATCCTAAGATACG (SEQ ID NO:29);
h) a primer pair for detecting Enterobius vermicularis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GCAGAGCTTTTCCAAAATTTATTTCC (SEQ ID NO:30) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCCAAGTTTGAGGTAATTTCTCG (SEQ ID NO:31);
i) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACTGGTGTAAGATTGAA (SEQ ID NO:32) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCAAGCATAACCTGACTCATATAC (SEQ ID NO:33);
j) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACTGGTGTAAGATTGAA (SEQ ID NO:34) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCAAGCATAACCTGACTCATATAC (SEQ ID NO:35);
k) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACAGGTGTGAGATTG (SEQ ID NO:36) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAAGCATAACCCGACTCGTA (SEQ ID NO:37);
l) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACAGGTGTGAGATTG (SEQ ID NO:36) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAAGCATAACCCGACTCGTA (SEQ ID NO:37);
m) a primer pair for detecting Schistosoma mansoni comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AGGTGTTTTCATGACTTTATATGTTGA (SEQ ID NO:38) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGCAGATGCAGATAAAGCCA (SEQ ID NO:39);
n) a primer pair for detecting Blastocystis hominis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CAGCTTTCGATGGTAGTGTATTG (SEQ ID NO:40) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of GGCTCCCTCTCCGAAATC (SEQ ID NO:41);
o) a primer pair for detecting Blastocystis hominis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of TCAGCTTTCGATGGTAGTATATGG (SEQ ID NO:42) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of GGCTCCCTCTCCGAAATC (SEQ ID NO:43);
p) a primer pair for detecting liver worms comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AGCTCGTAGTTGGATCTGG (SEQ ID NO:44) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCACCAATCATGCTAACACC (SEQ ID NO:45);
q) a primer pair for detecting Ancylostoma duodenale comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CAGTGTAGCTTGTGGCAC (SEQ ID NO:48) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAGCTAACGTACATGTTGCAATA (SEQ ID NO:49); and
r) a primer pair for detecting Ancylostoma duodenale comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of ACAGTGCAGCTTGTGGCA (SEQ ID NO:50) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAGCCAACGTACATGTTGCAATA (SEQ ID NO:51).
3 . The method according to claim 2 , wherein the set of oligonucleotides comprises primer pairs (a)-(p).
4 . The method according to claim 3 , wherein the forward and reverse primers of primer pairs (a)-(p) consist of at least 15 contiguous nucleotides of the nucleotide sequences of SEQ ID NOS: 17-45, respectively.
5 . (canceled)
6 . The method according to claim 1 , wherein said biological sample is a stool sample or a food sample.
7 . (canceled)
8 . The method according to claim 2 , wherein wherein the method comprises contacting the product of the nucleic acid amplification reaction with one or more probes selected from:
a) a probe for detecting Hymenolepis nana and Hymenolepis diminuta comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-AGTGTGCTTAGGTTGTAGTGTGTGGGCTCATC-3′ (SEQ ID NO:52);
b) a probe for detecting Hymenolepis nana and Hymenolepis diminuta comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-TGTTTGCCATGTTTTCTATTGTTTGTTTAGG-3′ (SEQ ID NO:53);
c) a probe for detecting Fasciolopsis buski comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-TTCGCCCATTCTTTGCCATTGCCC-3′ (SEQ ID NO:54);
d) a probe for detecting E. intestinalis, E. cuniculi , and E. hellem comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-CTGATCCTGCTGCTGGTTCTCCAACAG-3′ (SEQ ID NO:55);
e) a probe for detecting E. intestinalis, E. cuniculi , and E. hellem comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-ATGATCCTGCTAATGGTTCTCCAACAGCA-3′ (SEQ ID NO:56);
f) a probe for detecting E. intestinalis, E. cuniculi , and E. hellem comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-ATGATCCTGCTAATGGTTCTCCAACAGCA-3′ (SEQ ID NO:57);
g) a probe for detecting Enterocytozoon bieneusi comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-AGTGTCGCCTTCGCCTCCGTTAG-3′ (SEQ ID NO:58);
h) a probe for detecting Enterobius vermicularis comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-TCCGGCTCAGACATGAACATCAGTGAGTCT-3′ (SEQ ID NO:59);
i) a probe for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-ACACGACGTGGTAAACCGCACACA-3′ (SEQ ID NO:60);
j) a probe for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-ACACGACGTGGTAAACCGCACACA-3′ (SEQ ID NO:61);
k) a probe for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-ACACGACGTGGTAAACCGCACACA-3′ (SEQ ID NO:62);
l) a probe for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-ACACGACGTGGTAAACCGCACACA-3′ (SEQ ID NO:63);
m) a probe for detecting Schistosoma mansoni comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-CCCCTGTGACACCACCAACCGT-3′ (SEQ ID NO:64);
n) a probe for detecting Blastocystis hominis comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-AAATTCTTCGTTACCCGTTACTGCCATGGT-3′ (SEQ ID NO:65);
o) a probe for detecting Blastocystis hominis comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-AAATTCTTCGTTACCCGTTACTGCCATGGT-3′ (SEQ ID NO:66);
p) a probe for detecting liver worms comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-TTGCTCGTATTCCTGGCCTGGTTCA-3′ (SEQ ID NO:67).
9 . (canceled)
10 . The method according to claim 1 , wherein the method comprises detecting the presence or absence of at least Hymenolepis nana, Hymenolepis diminuta and liver worms, and wherein the target sequences comprise at least SEQ ID Nos: 1, 2 and 16.
11 . The method according to claim 10 , wherein the set of oligonucleotide primers comprises:
a) a primer pair for detecting Hymenolepis nana and Hymenolepis diminuta comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO:17) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGAACACTGCCGTCTTTACATCTAA (SEQ ID NO:18);
a primer pair for detecting Hymenolepis nana and Hymenolepis diminuta comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO:17) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AAATACAGCCGTCTTAACATCCAA (SEQ ID NO:19); and
c) a primer pair for detecting liver worms comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AGCTCGTAGTTGGATCTGG (SEQ ID NO:44) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCACCAATCATGCTAACACC (SEQ ID NO:45).
12 . The method according to claim 1 , wherein the method comprises detecting the presence or absence at least Enterocytozoon bieneusi, Enterobius vermicularis , and Schistosoma mansoni , and wherein the target sequences comprise SEQ ID Nos: 7, 8 and 13.
13 . The method according to claim 12 , wherein the set of oligonucleotide primers comprises:
a) a primer pair for detecting Enterocytozoon bieneusi comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GAGTGTAGTATAGACTGGCGAA (SEQ ID NO:28) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCGTCCTTGATCCTAAGATACG (SEQ ID NO:29);
b) a primer pair for detecting Enterobius vermicularis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GCAGAGCTTTTCCAAAATTTATTTCC (SEQ ID NO:30) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCCAAGTTTGAGGTAATTTCTCG (SEQ ID NO:31); and
c) a primer pair for detecting Schistosoma mansoni comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AGGTGTTTTCATGACTTTATATGTTGA (SEQ ID NO:38) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGCAGATGCAGATAAAGCCA (SEQ ID NO:39).
14 . (canceled)
15 . (canceled)
16 . (canceled)
17 . A composition comprising a set of oligonucleotide primers and probes, wherein the probes each comprise a detectable label, and wherein the set of primers comprises one or more primer pairs selected from:
a) a primer pair for detecting Hymenolepis nana and Hymenolepis diminuta comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO:17) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGAACACTGCCGTCTTTACATCTAA (SEQ ID NO:18);
b) a primer pair for detecting Hymenolepis nana and Hymenolepis diminuta comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO:17) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AAATACAGCCGTCTTAACATCCAA (SEQ ID NO:19);
c) a primer pair for detecting Fasciolopsis buski comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CACTGTTCAAGTGGTATTGATTG (SEQ ID NO:20) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCAGGTTATCAGTCCTACCC (SEQ ID NO:21);
d) a primer pair for detecting E. intestinalis, E. cuniculi , and E. hellem comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CTGAGTCCTGAGTGTTAGATAAGA (SEQ ID NO:22) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CTAATGCCAATCAATCCCGTG (SEQ ID NO:23);
e) a primer pair for detecting E. intestinalis, E. cuniculi , and E. hellem comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GTCCTTCGTGTTAGATAAGATATAAGTC (SEQ ID NO:24) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGATAATGCCAATCAATCCCATG (SEQ ID NO:25);
f) a primer pair for detecting E. intestinalis, E. cuniculi , and E. hellem comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GACGAAGATTGAGAGGTCTGA (SEQ ID NO:26) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CTAATGCCTATCAATCCCGTG (SEQ ID NO:27);
g) a primer pair for detecting Enterocytozoon bieneusi comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GAGTGTAGTATAGACTGGCGAA (SEQ ID NO:28) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCGTCCTTGATCCTAAGATACG (SEQ ID NO:29);
h) a primer pair for detecting Enterobius vermicularis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GCAGAGCTTTTCCAAAATTTATTTCC (SEQ ID NO:30) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCCAAGTTTGAGGTAATTTCTCG (SEQ ID NO:31);
i) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACTGGTGTAAGATTGAA (SEQ ID NO:32) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCAAGCATAACCTGACTCATATAC (SEQ ID NO:33);
j) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACTGGTGTAAGATTGAA (SEQ ID NO:34) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCAAGCATAACCTGACTCATATAC (SEQ ID NO:35);
k) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACAGGTGTGAGATTG (SEQ ID NO:36) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAAGCATAACCCGACTCGTA (SEQ ID NO:37);
l) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACAGGTGTGAGATTG (SEQ ID NO:36) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAAGCATAACCCGACTCGTA (SEQ ID NO:37);
m) a primer pair for detecting Schistosoma mansoni comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AGGTGTTTTCATGACTTTATATGTTGA (SEQ ID NO:38) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGCAGATGCAGATAAAGCCA (SEQ ID NO:39);
n) a primer pair for detecting Blastocystis hominis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CAGCTTTCGATGGTAGTGTATTG (SEQ ID NO:40) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of GGCTCCCTCTCCGAAATC (SEQ ID NO:41);
o) a primer pair for detecting Blastocystis hominis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of TCAGCTTTCGATGGTAGTATATGG (SEQ ID NO:42) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of GGCTCCCTCTCCGAAATC (SEQ ID NO:43);
p) a primer pair for detecting liver worms comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AGCTCGTAGTTGGATCTGG (SEQ ID NO:44) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCACCAATCATGCTAACACC (SEQ ID NO:45);
q) a primer pair for detecting Ancylostoma duodenale comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CAGTGTAGCTTGTGGCAC (SEQ ID NO:48) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAGCTAACGTACATGTTGCAATA (SEQ ID NO:49); and
r) a primer pair for detecting Ancylostoma duodenale comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of ACAGTGCAGCTTGTGGCA (SEQ ID NO:50) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAGCCAACGTACATGTTGCAATA (SEQ ID NO:51).
18 . The composition according to claim 17 , wherein the set of primer pairs comprises:
a) a primer pair for detecting Hymenolepis nana and Hymenolepis diminuta comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO:17) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGAACACTGCCGTCTTTACATCTAA (SEQ ID NO:18);
b) a primer pair for detecting Hymenolepis nana and Hymenolepis diminuta comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO:17) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AAATACAGCCGTCTTAACATCCAA (SEQ ID NO:19); and
c) a primer pair for detecting liver worms comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AGCTCGTAGTTGGATCTGG (SEQ ID NO:44) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCACCAATCATGCTAACACC (SEQ ID NO:45).
19 . The composition according to claim 17 , wherein the set of primer pairs comprises:
a) a primer pair for detecting Enterocytozoon bieneusi comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GAGTGTAGTATAGACTGGCGAA (SEQ ID NO:28) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCGTCCTTGATCCTAAGATACG (SEQ ID NO:29);
b) a primer pair for detecting Enterobius vermicularis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GCAGAGCTTTTCCAAAATTTATTTCC (SEQ ID NO:30) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCCAAGTTTGAGGTAATTTCTCG (SEQ ID NO:31); and
c) a primer pair for detecting Schistosoma mansoni comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AGGTGTTTTCATGACTTTATATGTTGA (SEQ ID NO:38) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGCAGATGCAGATAAAGCCA (SEQ ID NO:39).
20 . The composition according to claim 17 , wherein the probes comprise or consist of a sequence that is identical or complementary to at least 10 consecutive nucleotides of any of the probe sequences as set forth in SEQ ID NOS:52-67.
21 . (canceled)
22 . A kit for detecting the presence or absence of intestinal parasites in a sample, wherein said kit comprises a set of oligonucleotide primers and probes, wherein the probes each comprise a detectable label, and wherein the set of primers comprises one or more primer pairs selected from:
a) a primer pair for detecting Hymenolepis nana and Hymenolepis diminuta comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO:17) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGAACACTGCCGTCTTTACATCTAA (SEQ ID NO:18);
a primer pair for detecting Hymenolepis nana and Hymenolepis diminuta comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO:17) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AAATACAGCCGTCTTAACATCCAA (SEQ ID NO:19);
c) a primer pair for detecting Fasciolopsis buski comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CACTGTTCAAGTGGTATTGATTG (SEQ ID NO:20) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCAGGTTATCAGTCCTACCC (SEQ ID NO:21);
d) a primer pair for detecting E. intestinalis, E. cuniculi , and E. hellem comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CTGAGTCCTGAGTGTTAGATAAGA (SEQ ID NO:22) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CTAATGCCAATCAATCCCGTG (SEQ ID NO:23);
e) a primer pair for detecting E. intestinalis, E. cuniculi , and E. hellem comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GTCCTTCGTGTTAGATAAGATATAAGTC (SEQ ID NO:24) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGATAATGCCAATCAATCCCATG (SEQ ID NO:25);
f) a primer pair for detecting E. intestinalis, E. cuniculi , and E. hellem comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GACGAAGATTGAGAGGTCTGA (SEQ ID NO:26) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CTAATGCCTATCAATCCCGTG (SEQ ID NO:27);
g) a primer pair for detecting Enterocytozoon bieneusi comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GAGTGTAGTATAGACTGGCGAA (SEQ ID NO:28) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCGTCCTTGATCCTAAGATACG (SEQ ID NO:29);
h) a primer pair for detecting Enterobius vermicularis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GCAGAGCTTTTCCAAAATTTATTTCC (SEQ ID NO:30) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCCAAGTTTGAGGTAATTTCTCG (SEQ ID NO:31);
i) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACTGGTGTAAGATTGAA (SEQ ID NO:32) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCAAGCATAACCTGACTCATATAC (SEQ ID NO:33);
j) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACTGGTGTAAGATTGAA (SEQ ID NO:34) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCAAGCATAACCTGACTCATATAC (SEQ ID NO:35);
k) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACAGGTGTGAGATTG (SEQ ID NO:36) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAAGCATAACCCGACTCGTA (SEQ ID NO:37);
l) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACAGGTGTGAGATTG (SEQ ID NO:36) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAAGCATAACCCGACTCGTA (SEQ ID NO:37);
m) a primer pair for detecting Schistosoma mansoni comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AGGTGTTTTCATGACTTTATATGTTGA (SEQ ID NO:38) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGCAGATGCAGATAAAGCCA (SEQ ID NO:39);
n) a primer pair for detecting Blastocystis hominis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CAGCTTTCGATGGTAGTGTATTG (SEQ ID NO:40) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of GGCTCCCTCTCCGAAATC (SEQ ID NO:41);
o) a primer pair for detecting Blastocystis hominis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of TCAGCTTTCGATGGTAGTATATGG (SEQ ID NO:42) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of GGCTCCCTCTCCGAAATC (SEQ ID NO:43);
p) a primer pair for detecting liver worms comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AGCTCGTAGTTGGATCTGG (SEQ ID NO:44) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCACCAATCATGCTAACACC (SEQ ID NO:45);
q) a primer pair for detecting Ancylostoma duodenale comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CAGTGTAGCTTGTGGCAC (SEQ ID NO:48) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAGCTAACGTACATGTTGCAATA (SEQ ID NO:49); and
r) a primer pair for detecting Ancylostoma duodenale comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of ACAGTGCAGCTTGTGGCA (SEQ ID NO:50) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAGCCAACGTACATGTTGCAATA (SEQ ID NO:51).
23 . The kit according to claim 22 , comprising other PCR reagent components selected from the group consisting of: a polymerase, nucleotides, buffer, salts, detergents and/or other additives.
24 . The kit according to claim 22 , further comprising one or more control primers, additional probes or nucleotide sequences.
25 . The kit according to claim 22 , wherein the one or more probes comprise or consist of a sequence that is identical or complementary to at least 10 consecutive nucleotides of any of the probe sequences as set forth in SEQ ID NOS:52-67.
26 . The method according to claim 1 , wherein the method comprises detecting the presence or absence of one or more intestinal parasites and optionally one or more controls in a multiplex real-time PCR assay.