Granted Patent B2

US 12,428,642 · App. 17/847,770 · Granted Sep 30, 2025

Inventors: Hongyan Zhang (Suzhou, CN); Shan Gao (Suzhou, CN); Daiwu Kang (Suzhou, CN); Lina Kong (Suzhou, CN)

Assignee: SUZHOU RIBO LIFE SCIENCE CO., LTD.

C12N15/113A61P3/06C12N2310/14

Abstract

Claims (287)

1. A siRNA conjugate comprising siRNA and a conjugating group conjugated to the siRNA;

the siRNA comprising a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently a modified or unmodified nucleotide, wherein the sense strand comprises a nucleotide sequence I and the antisense strand comprises a nucleotide sequence II, said nucleotide sequence I and said nucleotide sequence II are at least partly reverse complementary to form a double-strand region, wherein the nucleotide sequence I comprises a nucleotide sequence A, which has the same length as the nucleotide sequence represented by SEQ ID NO: 1 with no more than 1 nucleotide differences, and the nucleotide sequence II comprises a nucleotide sequence B, which has the same length as the nucleotide sequence represented by SEQ ID NO:2 with no more than 1 nucleotide differences:

5′-CCAAGAGCACCAAGAACUZ-3′ (SEQ ID NO: 1);

(SEQ ID NO: 2)

5′-Z′AGUUCUUGGUGCUCUUGG-3′,

wherein, Z is A, and Z′ is U;

the nucleotide sequence A comprises nucleotide Z A at the corresponding position of Z, the nucleotide sequence B comprises nucleotide Z′ B at the corresponding position of Z′, wherein Z′ B is the first nucleotide at the 5′ terminal of the antisense strand;

the nucleotide difference between the nucleotide sequence B and the nucleotide sequence represented by SEQ ID NO:2 includes the difference at the position of Z′ B , wherein Z′ B is selected from A, C or G;

and the sense strand and antisense strand have the same or different length, wherein the sense strand has a length of 19 to 23 nucleotides, and the antisense strand has a length of 20 to 26 nucleotides;

wherein the conjugate has the structure represented by Formula (308):

wherein,

n1 is an integer of 1-3, and n3 is an integer of 0-4;

each of m1, m2, and m3 is independently an integer of 2-10;

each of R 10 , R 11 , R 12 , R 13 , R 14 and R 15 is independently H, or selected from the group consisting of C 1 -C 10 alkyl, C 1 -C 10 haloalkyl, and C 1 -C 10 alkoxy;

R 3 is a group having the structure represented by Formula A59:

wherein E 1 is OH, SH or BH 2 , and Nu is siRNA;

R 2 is a linear alkylene of 1 to 20 carbon atoms in length, wherein one or more carbon atoms are optionally replaced with one or more groups selected from the group consisting of: C(O), NH, O, S, CH═N, S(O) 2 , C 2 -C 10 alkenylene, C 2 -C 10 alkynylene, C 6 -C 10 arylene, C 3 -C 18 heterocyclylene, and C 5 -C 10 heteroarylene, and wherein R 2 is optionally substituted by any one or more groups selected from the group consisting of: C 1 -C 10 alkyl, C6-C 10 aryl, C5-C 10 heteroaryl, C 1 -C 10 haloalkyl, —OC 1 -C 10 alkyl, —OC 1 -C 10 alkylphenyl, —C 1 -C 10 alkyl-OH, —OC 1 -C 10 haloalkyl, —SC 1 -C 10 alkyl, —SC 1 -C 10 alkylphenyl, —C 1 -C 10 alkyl-SH, —SC 1 -C 10 haloalkyl, halo, —OH, —SH, —NH 2 , —C 1 -C 10 alkyl-NH 2 , —N(C 1 -C 10 alkyl)(C 1 -C 10 alkyl), —NH(C 1 -C 10 alkyl), cyano, nitro, —CO 2 H, —C(O)O(C 1 -C 10 alkyl), —CON(C 1 -C 10 alkyl)(C 1 -C 10 alkyl), —CONH(C 1 -C 10 alkyl), —CONH 2 , —NHC(O)(C 1 -C 10 alkyl), —NHC(O)(phenyl), —N(C 1 -C 10 alkyl)C(O)(C 1 -C 10 alkyl), —N(C 1 -C 10 alkyl)C(O)(phenyl), —C(O)C 1 -C 10 alkyl, —C(O)C 1 -C 10 alkylphenyl, —C(O)C 1 -C 10 haloalkyl, —OC(O)C 1 -C 10 alkyl, —SO 2 (C 1 -C 10 alkyl), —SO 2 (phenyl), —SO 2 (C 1 -C 10 haloalkyl), —SO 2 NH 2 , —SO 2 NH(C 1 -C 10 alkyl), —SO 2 NH(phenyl), —NHSO 2 (C 1 -C 10 alkyl), —NHSO 2 (phenyl), and —NHSO 2 (C 1 -C 10 haloalkyl);

each L 1 is a linear alkylene of 1 to 70 carbon atoms in length, wherein one or more carbon atoms are optionally replaced with one or more groups selected from the group consisting of: C(O), NH, O, S, CH═N, S(O) 2 , C 2 -C 10 alkenylene, C 2 -C 10 alkynylene, C 6 -C 10 arylene, C 3 -C 18 heterocyclylene, and C 5 -C 10 heteroarylene; and wherein L 1 is optionally substituted by any one or more groups selected from the group consisting of: C 1 -C 10 alkyl, C 6 -C 10 aryl, C 5 -C 10 heteroaryl, C 1 -C 10 haloalkyl, —OC 1 -C 10 alkyl, —OC 1 -C 10 alkylphenyl, —C 1 -C 10 alkyl-OH, —OC 1 -C 10 haloalkyl, —SC 1 -C 10 alkyl, —SC 1 -C 10 alkylphenyl, —C 1 -C 10 alkyl-SH, —SC 1 -C 10 haloalkyl, halo, —OH, —SH, —NH 2 , —C 1 -C 10 alkyl-NH 2 , —N(C 1 -C 10 alkyl)(C 1 -C 10 alkyl), —NH(C 1 -C 10 alkyl), cyano, nitro, —CO 2 H, —C(O)O(C 1 -C 10 alkyl), —CON(C 1 -C 10 alkyl)(C 1 -C 10 alkyl), —CONH(C 1 -C 10 alkyl), —CONH 2 , —NHC(O)(C 1 -C 10 alkyl), —NHC(O)(phenyl), —N(C 1 -C 10 alkyl)C(O)(C 1 -C 10 alkyl), —N(C 1 -C 10 alkyl)C(O)(phenyl), —C(O)C 1 -C 10 alkyl, —C(O)C 1 -C 10 alkylphenyl, —C(O)C 1 -C 10 haloalkyl, —OC(O)C 1 -C 10 alkyl, —SO 2 (C 1 -C 10 alkyl), —SO 2 (phenyl), —SO 2 (C 1 -C 10 haloalkyl), —SO 2 NH 2 , —SO 2 NH(C 1 -C 10 alkyl), —SO 2 NH(phenyl), —NHSO 2 (C 1 -C 10 alkyl), —NHSO 2 (phenyl), and —NHSO 2 (C 1 -C 10 haloalkyl);

represents a site where a group is attached to the rest of the molecule; and

M1 represents a targeting group.

2. The siRNA conjugate according to claim 1 , wherein the nucleotide sequence I further comprises nucleotide sequence III, the nucleotide sequence II further comprises nucleotide sequence IV, and the nucleotide sequence III and the nucleotide sequence IV each independently have a length of 1 to 4 nucleotides; the nucleotide sequence III is linked to the 5′ terminal of the nucleotide sequence A, the nucleotide sequence IV is linked to the 3′ terminal of the nucleotide sequence B, and the nucleotide sequence III and the nucleotide sequence IV have the same length and are reverse complementary.

3. The siRNA conjugate according to claim 2 , wherein the nucleotide sequence III and the nucleotide sequence IV both have a length of one nucleotide, and the nucleotide sequence III has a base of G;

or the nucleotide sequence III and the nucleotide sequence IV both have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the nucleotide sequence III has a base composition of AG;

or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 3 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the nucleotide sequence III has a base composition of AAG;

or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 4 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the nucleotide sequence III has a base composition of CAAG.

4. The siRNA conjugate according to claim 1 , wherein the nucleotide sequence II further comprises a nucleotide sequence V; the nucleotide sequence V has a length of 1 to 3 nucleotides, and is linked to the 3′terminal of the antisense strand, thereby forming a 3′ overhang terminal of the antisense strand.

5. The siRNA conjugate according to claim 4 , wherein, the nucleotide sequence V has a length 2 nucleotides; moreover the nucleotide sequence Vis 2 continuous thymine deoxyribonucleotides or 2 continuous uridine ribonucleotides, or the nucleotide sequence Vis complementary to the nucleotides at the corresponding positions of the target mRNA.

6. The siRNA conjugate according to claim 1 , wherein the sense strand of the siRNA comprises the nucleotide sequence represented by SEQ ID NO:3, and the antisense strand comprises the nucleotide sequence represented by SEQ ID NO:5:

(SEQ ID NO: 3)

5′-CCAAGAGCACCAAGAACUZ A -3′;

(SEQ ID NO: 5)

5′- Z′ B AGUUCUUGGUGCUCUUGGCU-3′;

or, the sense strand of siRNA comprises the nucleotide sequence represented by SEQ ID NO: 6, and the antisense strand comprises the nucleotide sequence represented by SEQ ID NO:7:

(SEQ ID NO: 6)

5′- AGCCAAGAGCACCAAGAACUZ A -3′;

(SEQ ID NO: 7)

5′- Z′ B AGUUCUUGGUGCUCUUGGCUUG-3′;

wherein, Z′ B is the first nucleotide at the 5′terminal of the antisense strand, Z A is selected from A, U, G or C, and Z′ B is a nucleotide complementary to Z A .

7. The siRNA conjugate according to claim 1 , wherein the siRNA is siAN1 or siAN2:

siAN1

Sense strand:

(SEQ ID NO: 8)

5′- CCAAGAGCACCAAGAACUA-3′

Antisense strand:

(SEQ ID NO: 9)

5′- UAGUUCUUGGUGCUCUUGGCU-3′

siAN2

Sense strand:

(SEQ ID NO: 10)

5′- AGCCAAGAGCACCAAGAACUA-3′

Antisense strand:

(SEQ ID NO: 11)

5′- UAGUUCUUGGUGCUCUUGGCUUG-3′.

8. The siRNA conjugate according to claim 1 , wherein each nucleotide in the sense strand and the antisense strand is independently a fluoro modified nucleotide or a non-fluoro modified nucleotide;

wherein the fluoro modified nucleotide is present in the nucleotide sequence A and the nucleotide sequence B; and in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 7, 8, 9 of the nucleotide sequence A are fluoro modified nucleotides; and in the direction from 5′terminal to 3′terminal, the nucleotides at positions 2, 6, 14 and 16 of the nucleotide sequence B are fluoro modified nucleotides.

9. The siRNA conjugate according to claim 8 , wherein each non-fluoro modified nucleotide is a methoxy modified nucleotide, and the methoxy modified nucleotide refers to a nucleotide formed by replacing 2′-hydroxy of the ribose group with a methoxy group.

10. The siRNA conjugate according to claim 9 , wherein in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 5, 7, 8 and 9 of the nucleotide sequence A in the sense strand of the siRNA are fluoro modified nucleotides, and the nucleotides at the other positions in the sense strand of the siRNA are methoxy modified nucleotides; and in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 2, 6, 8, 9, 14 and 16 of the nucleotide sequence B in the sense strand of the siRNA are fluoro modified nucleotides, and the nucleotides at the other positions in the sense strand of siRNA are methoxy modified nucleotides;

or, in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 5, 7, 8 and 9 of the nucleotide sequence A in the sense strand of the siRNA are fluoro modified nucleotides, and the nucleotides at the other positions in the sense strand of the siRNA are methoxy modified nucleotides; and in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 2, 6, 14 and 16 in the nucleotide sequence B in the antisense strand of the siRNA are fluoro modified nucleotides, and the nucleotides at the other positions in the antisense strand of the siRNA are methoxy modified nucleotides;

or, in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 7, 8 and 9 of the nucleotide sequence A in the sense strand of the siRNA are fluoro modified nucleotides, and the nucleotides at the other positions in the sense strand of the siRNA are methoxy modified nucleotides; and in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 2, 6, 14 and 16 of the nucleotide sequence B in the antisense strand of the siRNA are fluoro modified nucleotides, and the nucleotides at the other positions in the antisense strand of the siRNA are methoxy modified nucleotides.

11. The siRNA conjugate according to claim 1 , wherein the siRNA is any one of siAN1-M1, siAN2-M1, siAN1-M2, siAN2-M2, siAN1-M3, and siAN2-M3:

siAN1-M1

sense strand:

(SEQ ID NO: 12)

5′-CmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 13)

5′-UmAfGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmCmUm-3′

siAN2-M1

sense strand:

(SEQ ID NO: 14)

5′-AmGmCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 15)

5′-UmAfGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmCmUmUmGm-

3′

siAN1-M2

sense strand:

(SEQ ID NO: 12)

5′-CmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 16)

5′-UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUm-3′

siAN2-M2

sense strand:

(SEQ ID NO: 14)

5′-AmGmCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 17)

5′-UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmUmGm-

3′

siAN1-M3

sense strand:

(SEQ ID NO: 18)

5′-CmCmAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 16)

5′-UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUm-3′

siAN2-M3

sense strand:

(SEQ ID NO: 19)

5′-AmGmCmCmAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 17)

5′-UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmUmGm-

3′,

wherein C, G, U, and A represent the base composition of the nucleotides; m represents that the nucleotide adjacent to the left side of the letter m is a methoxy modified nucleotide; and f represents that the nucleotide adjacent to the left side of the letter f is a fluoro modified nucleotide.

12. The siRNA conjugate according to claim 1 , wherein in the siRNA, at least one phosphate group is a phosphorothioate group, and the phosphorothioate linkage is present at at least one of the following positions:

the position between the first and second nucleotides at 5′ terminal of the sense strand;

the position between the second and third nucleotides at 5′ terminal of the sense strand;

the position between the first and second nucleotides at 3′ terminal of the sense strand;

the position between the second and third nucleotides at 3′ terminal of the sense strand;

the position between the first and second nucleotides at 5′ terminal of the antisense strand;

the position between the second and third nucleotides at 5′ terminal of the antisense strand;

the position between the first and second nucleotides at 3′ terminal of the antisense strand; and

the position between the second and third nucleotides at 3′ terminal of the antisense strand.

13. The siRNA conjugate according to claim 1 , wherein the siRNA is any one of siAN1-MIS, siAN2-MIS, siAN1-M2S, siAN2-M2S, siAN1-M3S, and siAN2-M3S:

siAN1-MiS

sense strand:

(SEQ ID NO: 20)

5′-CmsCmsAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 21)

5′-UmsAfsGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmsCmsUm-

3′

siAN2-M1S

sense strand:

(SEQ ID NO: 22)

5′-AmsGmsCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 23)

5′-UmsAfsGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmCmUmsU

msGm-3′

siAN1-M25

sense strand:

(SEQ ID NO: 20)

5′-CmsCmsAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 24)

5′-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm-

3′

siAN2-M2S

sense strand:

(SEQ ID NO: 22)

5′-AmsGmsCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 25)

5′-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmsU

msGm-3′

siAN1-M3S

sense strand:

(SEQ ID NO: 26)

5′-CmsCmsAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 24)

5′-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm-

3′

siAN2-M3S

sense strand:

(SEQ ID NO: 27)

5′-AmsGmsCmCmAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 25)

5′-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmsU

msGm-3′,

wherein C, G, U, and A represent the base composition of the nucleotides; m represents that the nucleotide adjacent to the left side of the letter m is a methoxy modified nucleotide; f represents that the nucleotide adjacent to the left side of the letter f is a fluoro modified nucleotide; and s represents that a phosphorothioate linkage is present between the two nucleotides adjacent to both sides of the letter s.

14. The siRNA conjugate according to claim 1 , wherein the nucleotide at 5′ terminal of the antisense strand is a 5′-phosphate nucleotide or a 5′-phosphate analogue modified nucleotide; or wherein the 5′-phosphate nucleotide is a nucleotide having the structure represented by Formula (2), and the 5′-phosphate analogue modified nucleotide is a nucleotide having the structure represented by any of formulae (3)-(6):

wherein R is selected from H, OH, methoxy, or F; “Base” represents a base selected from A, U, C, G, or T.

15. The siRNA conjugate according to claim 1 , wherein the siRNA is any one of siAN1-M1P1, siAN2-M1P1, siAN1-M2P1, siAN2-M2P1, siAN1-M3P1, siAN2-M3P1, siAN1-M1SP1, siAN2-M1SP1, siAN1-M2SP1, siAN2-M2SP1, siAN1-M3SP1, and siAN2-M3SP1:

siAN1-M1P1

sense strand:

(SEQ ID NO: 12)

5′-CmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 28)

5′-P1-UmAfGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmCmUm-

3′

siAN2-M1P1

sense strand:

(SEQ ID NO: 14)

5′-AmGmCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 29)

5′-P1-UmAfGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmCmUmU

mGm-3′

siAN1-M2P1

sense strand:

(SEQ ID NO: 12)

5′-CmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 30)

5′-P1-UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUm-

3′

siAN2-M2P1

sense strand:

(SEQ ID NO: 14)

5′-AmGmCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 31)

5′-P1-UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmU

mGm-3′

siAN1-M3P1

sense strand:

(SEQ ID NO: 18)

5′-CmCmAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 30)

5′-P1-UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUm-

3′

siAN2-M3P1

sense strand:

(SEQ ID NO: 19)

5′-AmGmCmCmAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 31)

5′-P1-UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmU

mUmGm-3′

siAN1-M1SP1

sense strand:

(SEQ ID NO: 20)

5′-CmsCmsAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 32)

5′-P1-UmsAfsGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmsC

msUm-3′

siAN2-M1SP1

sense strand:

(SEQ ID NO: 22)

5′-AmsGmsCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 33)

5′-P1-UmsAfsGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmCmU

msUmsGm-3′

siAN1-M2SP1

sense strand:

(SEQ ID NO: 20)

5′-CmsCmsAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 34)

5′-P1-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsC

msUm-3′

siAN2-M2SP1

sense strand:

(SEQ ID NO: 22)

5′-AmsGmsCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 35)

5′-P1-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmU

msUmsGm-3′

siAN1-M3SP1

sense strand:

(SEQ ID NO: 26)

5′-CmsCmsAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 34)

5′-P1-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCms

Um-3′

siAN2-M3SP1

sense strand:

(SEQ ID NO: 27)

5′-AmsGmsCmCmAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm-3′

antisense strand:

(SEQ ID NO: 35)

5′-P1-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmU

msUmsGm-3′

wherein C, G, U, and A represent the base composition of the nucleotides; m represents that the nucleotide adjacent to the left side of the letter m is a methoxy modified nucleotide; f represents that the nucleotide adjacent to the left side of the letter f is a fluoro modified nucleotide; s represents that a phosphorothioate linkage is present between the two nucleotides adjacent to both sides of the letter s; and P1 represents that the nucleotide adjacent to the right side of P1 is a 5′-phosphate nucleotide or a 5′-phosphate analogue modified nucleotide.

16. The siRNA conjugate according to claim 1 , wherein each L 1 is independently selected from connection combinations of one or more of the groups having Formulae A1-A26:

wherein, j1 is an integer of 1-20; j2 is an integer of 1-20;

R′ is a C-C 10 alkyl;

Ra is selected from the group consisting of Formulae A27-A45 and any combination thereof:

Rb is a C 1 -C 10 alkyl.

17. The siRNA conjugate according to claim 16 , wherein L 1 is selected from connection combinations of one or more of A1, A4, A5, A6, A8, A10, A11, A13; or L 1 is selected from connection combinations of at least two of A1, A4, A8, A10, and A11.

18. The siRNA conjugate according to claim 1 , wherein L 1 is 3 to 25 atoms in length; or L 1 is further 4 to 15 atoms in length.

19. The siRNA conjugate according to claim 1 , wherein m1, m2 and m3 are each independently an integer of 2-5; or wherein m1=m2=m3.

20. The siRNA conjugate according to claim 1 , wherein each of the targeting groups is independently a ligand having affinity to asialoglycoprotein receptors on the surface of mammalian hepatocytes; or

each of the targeting group is independently selected from the group consisting of D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl-a-neuraminic acid, 5-thio-β-D-glucopyranose, methyl 2,3,4-tris-O-acetyl-1-thio-6-O-trityl-a-D-glucopyranoside, 4-thio-β-D-galactopyranose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-a-D-glucoheptopyranoside, 2,5-anhydro-D-allononitrile, ribose, D-ribose, D-4-thioribose, L-ribose, and L-4-thioribose.

21. The siRNA conjugate according to claim 1 , wherein R 2 comprises both a site linking to the N atom on the nitrogenous backbone and a site linking to the P atom in R 3 ; and

in R 2 , the site linking to the N atom on the nitrogenous backbone forms an amide bond with the N atom, and the site linking to the P in R 3 forms a phosphoester bond with the P; or

wherein R 2 is selected from B5, B6, B5′ or B6′:

wherein represents the site where a group is covalently linked, and

q 2 is an integer of 1-10.

22. The siRNA conjugate according to claim 1 , wherein the conjugate has the structure represented by Formula (403), (404), (405), (406), (407), (408), (409), (410), (411), (412), (413), (414), (415), (416), (417), (418), (419), (420), (421) or (422):

23. The siRNA conjugate according to claim 1 , wherein the P atom in the Formula A59 is linked to 3′ terminal of the sense strand of the siRNA.

24. The siRNA conjugate according to claim 1 , wherein n1 is an integer of 1-2, n3 is an integer of 0-1, and n1+n3=2-3.

25. A kit comprising the siRNA conjugate according to claim 1 .

26. A method for treating dyslipidemia, wherein the method comprises administering an effective amount of the siRNA conjugate according to claim 1 to a subject suffering from dyslipidemia.

27. A method for inhibiting the expression of ANGPTL3 gene in hepatocytes, comprising contacting an effective amount of the siRNA conjugate according to claim 1 with the hepatocytes.

28. The method of claim 26 , wherein the dyslipidemia is hypercholesteremia, hypertriglyceridemia or atherosclerosis.

Assignments (1)

Priority Claims (2)

Continuity (2)

References Cited (400)