IP Library › Patent Application 18057186

Patent Application

App. No. 18/057,186

DOUBLE STRANDED RNA TARGETING ANGIOPOIETIN-LIKE 3 (ANGPTL-3) AND METHODS OF USE THEREOF

Loading inventors, assignments & file history…

Monitor This Case

Get email alerts when status or documents change.

Order Certified Copies

Most orders are placed with the USPTO same day — all within 24 business hours.

Order via The Patent Place →

Pre-filled with this patent's details

Quick Facts

Patent No.: US None
App. No.: 18/057,186

External Links

USPTO Patent Center↗ Full Patent PDF↗

Abstract

The disclosure relates to isolated oligonucleotides comprising duplex regions targeting angiopoietin-like 3 (ANGPTL-3), and delivery systems, kits and compositions comprising same, and methods of using same for inhibiting or downregulating ANGPTL-3.

Claims (260)

1 . An isolated oligonucleotide comprising a sense strand and an anti-sense strand, wherein:

the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising 19-25 nucleotides between any one of the nucleotide positions selected from:

a) 52 to 93;

b) 133 to 184;

c) 246 to 304;

d) 337 to 414;

e) 433 to 503;

f) 522 to 571;

g) 617 to 700;

h) 717 to 737;

i) 836 to 905;

j) 944 to 964;

k) 1013 to 1093;

l) 1353 to 1386; and

m) 1407 to 1427,

from the 5′ end of an Angiopoietin-like protein 3 (ANGPTL-3) mRNA sequence according to SEQ ID NO: 1,

and the anti-sense strand is substantially complementary to the sense strand such that the sense strand and the anti-sense strand together form a double stranded region.

2 .- 3 . (canceled)

4 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a nucleotide sequence that is substantially identical to a region between any one of the nucleotide positions selected from:

a) 523 to 543;

b) 680 to 700; and

c) 1058 to 1078,

from the 5′ end of an ANGPTL-3 mRNA sequence according to SEQ ID NO: 1.

5 .- 6 . (canceled)

7 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a nucleotide sequence that is substantially identical to a region between any one of the nucleotide positions selected from:

a) 52 to 93;

b) 133 to 184;

c) 275 to 304;

d) 342 to 377;

e) 453 to 503;

f) 548 to 571;

g) 673 to 699;

h) 717 to 737;

i) 836 to 905;

j) 944 to 964;

k) 1013 to 1093; and

l) 1353 to 1427,

from the 5′ end of an ANGPTL-3 mRNA sequence according to SEQ ID NO: 1.

8 .- 9 . (canceled)

10 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a sequence that is substantially identical to a region between any one of the nucleotide positions selected from:

a) 54 to 74;

b) 148 to 179;

c) 246 to 282;

d) 337 to 414;

e) 433 to 495;

f) 522 to 542;

g) 617 to 637;

h) 838 to 858; and

i) 1361 to 1381,

from the 5′ end of an ANGPTL-3 mRNA sequence according to SEQ ID NO: 1.

11 .- 26 . (canceled)

27 . The isolated oligonucleotide of claim 1 , wherein the anti-sense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 2-62 and 200.

28 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 63-123 and 235.

29 . The isolated oligonucleotide of claim 4 , wherein the double stranded region comprises:

i) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 7 (5′ UUUUUAAGUGAAGUUACUUCUG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 68 (5′ GAAGUAACUUCACUUAAAAA 3′);

ii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 8 (5′ UGAAGAUAGAGAAAUUUCUGUG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 69 (5′ CAGAAAUUUCUCUAUCUUCA 3′); or

iii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 10 (5′ UUAAUGUUUGUUGUCUUUCCAG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 71 (5′ GGAAAGACAACAAACAUUAA 3′).

30 . The isolated oligonucleotide of claim 7 , wherein the double stranded region comprises:

i) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 2 (5′ UCAAUAAAAAGAAGGAGCUUAA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 63 (5′ AAGCUCCUUCUUUUUAUUGA 3′);

ii) an anti-sense of nucleotide sequence according to SEQ ID NO: 3 (5′ UAAAUUUUUACAUCGUCUAACA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 64 (5′ UUAGACGAUGUAAAAAUUUA 3′);

iii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 4 (5′ UAUAAAAAGACUGAUCAAAUAU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 65 (5′ AUUUGAUCAGUCUUUUUAUA 3′);

iv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 11 (5′ UGUAUAACCUUCCAUUUUGAGA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 72 (5′ UCAAAAUGGAAGGUUAUACA 3′);

v) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 13 (5′ UUUGAUUUUAUAGAGUAUAACC 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 74 (5′ UUAUACUCUAUAAAAUCAAA 3′);

vi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 14 (5′ UAAAGAAGGAGCUUAAUUGUGA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 75 (5′ ACAAUUAAGCUCCUUCUUUA 3′);

vii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 15 (5′ UAUAAAAAGAAGGAGCUUAAUU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 76 (5′ UUAAGCUCCUUCUUUUUAUA 3′);

viii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 16 (5′ UAAUAAAAAGAAGGAGCUUAAU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 77 (5′ UAAGCUCCUUCUUUUUAUUA 3′);

ix) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 17 (5′ UAAAUAACUAGAGGAACAAUAA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 78 (5′ AUUGUUCCUCUAGUUAUUUA 3′);

x) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 18 (5′ UAAAUCUUGAUUUUGGCUCUGG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 79 (5′ AGAGCCAAAAUCAAGAUUUA 3′);

xi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 19 (5′ UCAUAGCAAAUCUUGAUUUUGG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 80 (5′ AAAAUCAAGAUUUGCUAUGA 3′);

xii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 20 (5′ UUUGAUUUUGGCUCUGGAGAUA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 81 (5′ UCUCCAGAGCCAAAAUCAAA 3′);

xiii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 21 (5′ UAUCGUCUAACAUAGCAAAUCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 82 (5′ AUUUGCUAUGUUAGACGAUA 3′);

xiv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 22 (5′ UAUUUUUACAUCGUCUAACAUA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 83 (5′ UGUUAGACGAUGUAAAAAUA 3′);

xv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 23 (5′ UAAAAUUUUUACAUCGUCUAAC 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 84 (5′ UAGACGAUGUAAAAAUUUUA 3′);

xvi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 24 (5′ UGAUAGAUCAUAAAAAGACUGA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 85 (5′ AGUCUUUUUAUGAUCUAUCA 3′);

xvii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 25 (5′ UUAAAAAGACUGAUCAAAUAUG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 86 (5′ UAUUUGAUCAGUCUUUUUAA 3′);

xviii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 26 (5′ UAUAGAUCAUAAAAAGACUGAU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 87 (5′ CAGUCUUUUUAUGAUCUAUA 3′);

xix) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 27 (5′ UUAGUUUAUAUGUAGUUCUUCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 88 (5′ AAGAACUACAUAUAAACUAA 3′);

xx) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 28 (5′ UUUUAUAUGUAGUUCUUCUCAG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 89 (5′ GAGAAGAACUACAUAUAAAA 3′);

xxi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 29 (5′ UAUUUUUGACUUGUAGUUUAUA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 90 (5′ UAAACUACAAGUCAAAAAUA 3′);

xxii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 30 (5′ UUUAAGUUAGUUAGUUGCUCUU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 91 (5′ GAGCAACUAACUAACUUAAA 3′);

xxiii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 31 (5′ UAUUAAGUUAGUUAGUUGCUCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 92 (5′ AGCAACUAACUAACUUAAUA 3′);

xxiv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 32 (5′ UUUGAUUUUGAAUUAAGUUAGU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 93 (5′ UAACUUAAUUCAAAAUCAAA 3′);

xxv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 33 (5′ UUUCUAAAUAUUUCACUUUUUG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 94 (5′ AAAAGUGAAAUAUUUAGAAA 3′);

xxvi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 34 (5′ UUUAGUUAGUUGCUCUUCUAAA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 95 (5′ UAGAAGAGCAACUAACUAAA 3′);

xxvii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 35 (5′ UCUAUUAUCUUGUUUUUCUACA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 96 (5′ UAGAAAAACAAGAUAAUAGA 3′);

xxviii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 36 (5′ UAUGCUAUUAUCUUGUUUUUCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 97 (5′ AAAAACAAGAUAAUAGCAUA 3′);

xxix) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 37 (5′ UAAGAUAGAGAAAUUUCUGUGG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 98 (5′ ACAGAAAUUUCUCUAUCUUA 3′);

xxx) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 38 (5′ UGAGAAAUUUCUGUGGGUUCUU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 99 (5′ GAACCCACAGAAAUUUCUCA 3′);

xxxi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 39 (5′ UCUGAAGAAAGGGAGUAGUUCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 100 (5′ AACUACUCCCUUUCUUCAGA 3′);

xxxii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 40 (5′ UAAAACUUGAGAGUUGCUGGGU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 101 (5′ CCAGCAACUCUCAAGUUUUA 3′);

xxxiii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 41 (5′ UUUGAAUUAAUGUCCAUGGACU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 102 (5′ UCCAUGGACAUUAAUUCAAA 3′);

xxxiv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 42 (5′ UAAACCAUAUUUGUAGUUCUCC 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 103 (5′ AGAACUACAAAUAUGGUUUA 3′);

xxxv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 43 (5′ UUAAUUAGAUUGCUUCACUAUG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 104 (5′ UAGUGAAGCAAUCUAAUUAA 3′);

xxxvi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 44 (5′ UUAUAAUGUUUGUUGUCUUUCC 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 105 (5′ AAAGACAACAAACAUUAUAA 3′);

xxxvii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 45 (5′ UAUAUAAUGUUUGUUGUCUUUC 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 106 (5′ AAGACAACAAACAUUAUAUA 3′);

xxxviii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 46 (5′ UAAAGAAUAUUCAAUAUAAUGU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 107 (5′ AUUAUAUUGAAUAUUCUUUA 3′); or

xxxix) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 200 (5′ UUUCAAAGCUUUCUGAAUCUGU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 235 (5′ AGAUUCAGAAAGCUUUGAAA 3′).

31 . The isolated oligonucleotide of claim 10 , wherein the double stranded region comprises:

i) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 5 (5′ UGACAUAUUCUUUACCUCUUCA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 66 (5′ AAGAGGUAAAGAAUAUGUCA 3′);

ii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 6 (5′ UUUUAAGUGAAGUUACUUCUGG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 67 (5′ AGAAGUAACUUCACUUAAAA 3′);

iii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 9 (5′ UGAAAAACUUGAGAGUUGCUGG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 70 (5′ AGCAACUCUCAAGUUUUUCA 3′);

iv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 12 (5′ UUUUAUAGAGUAUAACCUUCCA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 73 (5′ GAAGGUUAUACUCUAUAAAA 3′);

v) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 47 (5′ UAAAAAGAAGGAGCUUAAUUGU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 108 (5′ AAUUAAGCUCCUUCUUUUUA 3′);

vi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 48 (5′ UUUUACAUCGUCUAACAUAGCA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 109 (5′ CUAUGUUAGACGAUGUAAAA 3′);

vii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 49 (5′ UUUUUACAUCGUCUAACAUAGC 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 110 (5′ UAUGUUAGACGAUGUAAAAA 3′);

viii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 50 (5′ UCUAACAUAGCAAAUCUUGAUU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 111 (5′ UCAAGAUUUGCUAUGUUAGA 3′);

ix) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 51 (5′ UUUGAAAUAUGUCAUUAAUUUG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 112 (5′ AAUUAAUGACAUAUUUCAAA 3′);

x) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 52 (5′ UCAAAUAUGUUGAGUUUUUGAA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 113 (5′ CAAAAACUCAACAUAUUUGA 3′);

xi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 53 (5′ UAUGUAGUUCUUCUCAGUUCCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 114 (5′ GAACUGAGAAGAACUACAUA 3′);

xii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 54 (5′ UUUAUAUGUAGUUCUUCUCAGU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 115 (5′ UGAGAAGAACUACAUAUAAA 3′);

xiii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 55 (5′ UCAAGUGACAUAUUCUUUACCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 116 (5′ GUAAAGAAUAUGUCACUUGA 3′);

xiv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 56 (5′ UUUGAGUUGAGUUCAAGUGACA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 117 (5′ UCACUUGAACUCAACUCAAA 3′);

xv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 57 (5′ UAAGUUAGUUAGUUGCUCUUCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 118 (5′ AAGAGCAACUAACUAACUUA 3′);

xvi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 58 (5′ UGAAUUAAGUUAGUUAGUUGCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 119 (5′ CAACUAACUAACUUAAUUCA 3′);

xvii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 59 (5′ UGUUGAAGUAGAAUUUUUUCUU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 120 (5′ GAAAAAAUUCUACUUCAACA 3′);

xviii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 60 (5′ UUUGUUGAAGUAGAAUUUUUUC 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 121 (5′ AAAAAUUCUACUUCAACAAA 3′);

xix) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 61 (5′ UUUCACUUUUUGUUGAAGUAGA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 122 (5′ UACUUCAACAAAAAGUGAAA 3′); or

xx) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 62 (5′ UUUUAUUUGACUAUGCUGUUGG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 123 (5′ AACAGCAUAGUCAAAUAAAA 3′).

32 . (canceled)

33 . The isolated oligonucleotide of claim 1 , wherein the double stranded region comprises:

i) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 3 (5′ UAAAUUUUUACAUCGUCUAACA), and a sense strand of nucleotide sequence according to SEQ ID NO: 64 (5′ UUAGACGAUGUAAAAAUUUA 3′);

ii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 4 (5′ UAUAAAAAGACUGAUCAAAUAU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 65 (5′ AUUUGAUCAGUCUUUUUAUA 3′);

iii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 7 (5′ UUUUUAAGUGAAGUUACUUCUG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 68 (5′ GAAGUAACUUCACUUAAAAA 3′);

iv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 8 (5′ UGAAGAUAGAGAAAUUUCUGUG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 69 (5′ CAGAAAUUUCUCUAUCUUCA 3′);

v) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 9 (5′ UGAAAAACUUGAGAGUUGCUGG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 70 (5′ AGCAACUCUCAAGUUUUUCA 3′);

vi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 10 (5′ UUAAUGUUUGUUGUCUUUCCAG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 71 (5′ GGAAAGACAACAAACAUUAA 3′);

vii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 12 (5′ UUUUAUAGAGUAUAACCUUCCA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 73 (5′ GAAGGUUAUACUCUAUAAAA 3′);

viii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 14 (5′ UAAAGAAGGAGCUUAAUUGUGA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 75 (5′ ACAAUUAAGCUCCUUCUUUA 3′);

ix) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 16 (5′ UAAUAAAAAGAAGGAGCUUAAU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 77 (5′ UAAGCUCCUUCUUUUUAUUA 3′);

x) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 17 (5′ UAAAUAACUAGAGGAACAAUAA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 78 (5′ AUUGUUCCUCUAGUUAUUUA 3′);

xi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 20 (5′ UUUGAUUUUGGCUCUGGAGAUA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 81 (5′ UCUCCAGAGCCAAAAUCAAA 3′);

xii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 21 (5′ UAUCGUCUAACAUAGCAAAUCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 82 (5′ AUUUGCUAUGUUAGACGAUA 3′);

xiii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 24 (5′ UGAUAGAUCAUAAAAAGACUGA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 85 (5′ AGUCUUUUUAUGAUCUAUCA 3′);

xiv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 25 (5′ UUAAAAAGACUGAUCAAAUAUG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 86 (5′ UAUUUGAUCAGUCUUUUUAA 3′);

xv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 26 (5′ UAUAGAUCAUAAAAAGACUGAU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 87 (5′ CAGUCUUUUUAUGAUCUAUA 3′);

xvi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 27 (5′ UUAGUUUAUAUGUAGUUCUUCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 88 (5′ AAGAACUACAUAUAAACUAA 3′);

xvii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 30 (5′ UUUAAGUUAGUUAGUUGCUCUU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 91 (5′ GAGCAACUAACUAACUUAAA 3′);

xiii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 32 (5′ UUUGAUUUUGAAUUAAGUUAGU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 93 (5′ UAACUUAAUUCAAAAUCAAA 3′);

xix) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 33 (5′ UUUCUAAAUAUUUCACUUUUUG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 94 (5′ AAAAGUGAAAUAUUUAGAAA 3′);

xx) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 35 (5′ UCUAUUAUCUUGUUUUUCUACA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 96 (5′ UAGAAAAACAAGAUAAUAGA 3′);

xxi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 37 (5′ UAAGAUAGAGAAAUUUCUGUGG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 98 (5′ ACAGAAAUUUCUCUAUCUUA 3′);

xxii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 38 (5′ UGAGAAAUUUCUGUGGGUUCUU 3′), and an sense strand of nucleotide sequence according to SEQ ID NO: 99 (5′ GAACCCACAGAAAUUUCUCA 3′);

xxiii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 39 (5′ UCUGAAGAAAGGGAGUAGUUCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 100 (5′ AACUACUCCCUUUCUUCAGA 3′);

xxiv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 40 (5′ UAAAACUUGAGAGUUGCUGGGU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 101 (5′ CCAGCAACUCUCAAGUUUUA 3′);

xxv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 41 (5′ UUUGAAUUAAUGUCCAUGGACU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 102 (5′ UCCAUGGACAUUAAUUCAAA 3′);

xxvi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 43 (5′ UUAAUUAGAUUGCUUCACUAUG 3′), and an anti-sense strand of nucleotide sequence according to SEQ ID NO: 104 (5′ UAGUGAAGCAAUCUAAUUAA 3′);

xxvii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 5 (5′ UGACAUAUUCUUUACCUCUUCA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 66 (5′ AAGAGGUAAAGAAUAUGUCA 3′);

xxviii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 44 (5′ UUAUAAUGUUUGUUGUCUUUCC 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 105 (5′ AAAGACAACAAACAUUAUAA 3′);

xxix) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 47 (5′ UAAAAAGAAGGAGCUUAAUUGU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 108 (5′ AAUUAAGCUCCUUCUUUUUA 3′);

xxx) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 48 (5′ UUUUACAUCGUCUAACAUAGCA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 109 (5′ CUAUGUUAGACGAUGUAAAA 3′);

xxxi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 49 (5′ UUUUUACAUCGUCUAACAUAGC 3′), and an anti-sense strand of nucleotide sequence according to SEQ ID NO: 110 (5′ UAUGUUAGACGAUGUAAAAA 3′);

xxxii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 50 (5′ UCUAACAUAGCAAAUCUUGAUU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 111 (5′ UCAAGAUUUGCUAUGUUAGA 3′);

xxxiii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 51 (5′ UUUGAAAUAUGUCAUUAAUUUG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 112 (5′ AAUUAAUGACAUAUUUCAAA 3′);

xxxiv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 52 (5′ UCAAAUAUGUUGAGUUUUUGAA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 113 (5′ CAAAAACUCAACAUAUUUGA 3′);

xxxv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 53 (5′ UAUGUAGUUCUUCUCAGUUCCU 3′), and an anti-sense strand of nucleotide sequence according to SEQ ID NO: 114 (5′ GAACUGAGAAGAACUACAUA 3′);

xxxvi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 54 (5′ UUUAUAUGUAGUUCUUCUCAGU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 115 (5′ UGAGAAGAACUACAUAUAAA 3′);

xxxvii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 55 (5′ UCAAGUGACAUAUUCUUUACCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 116 (5′ GUAAAGAAUAUGUCACUUGA 3′);

xxxviii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 56 (5′ UUUGAGUUGAGUUCAAGUGACA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 117 (5′ UCACUUGAACUCAACUCAAA 3′);

xxxix) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 58 (5′ UGAAUUAAGUUAGUUAGUUGCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 119 (5′ CAACUAACUAACUUAAUUCA 3′);

xL) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 59 (5′ UGUUGAAGUAGAAUUUUUUCUU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 120 (5′ GAAAAAAUUCUACUUCAACA 3′);

xLi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 60 (5′ UUUGUUGAAGUAGAAUUUUUUC 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 121 (5′ AAAAAUUCUACUUCAACAAA 3′);

xLii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 61 (5′ UUUCACUUUUUGUUGAAGUAGA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 122 (5′ UACUUCAACAAAAAGUGAAA 3′);

xLiii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 62 (5′ UUUUAUUUGACUAUGCUGUUGG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 123 (5′ AACAGCAUAGUCAAAUAAAA 3′);

xLiv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 28 (5′ UUUUAUAUGUAGUUCUUCUCAG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 89 (5′ GAGAAGAACUACAUAUAAAA 3′); or

xLv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 200 (5′ UUUCAAAGCUUUCUGAAUCUGU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 235 (5′ AGAUUCAGAAAGCUUUGAAA 3′).

34 . (canceled)

35 . The isolated oligonucleotide of claim 1 , wherein the double stranded region comprises:

iii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 11 (5′ UGUAUAACCUUCCAUUUUGAGA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 72 (5′ UCAAAAUGGAAGGUUAUACA 3′);

iv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 13 (5′ UUUGAUUUUAUAGAGUAUAACC 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 74 (5′ UUAUACUCUAUAAAAUCAAA 3′);

v) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 15 (5′ UAUAAAAAGAAGGAGCUUAAUU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 76 (5′ UUAAGCUCCUUCUUUUUAUA 3′);

vi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 18 (5′ UAAAUCUUGAUUUUGGCUCUGG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 79 (5′ AGAGCCAAAAUCAAGAUUUA 3′);

vii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 19 (5′ UCAUAGCAAAUCUUGAUUUUGG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 80 (5′ AAAAUCAAGAUUUGCUAUGA 3′);

viii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 22 (5′ UAUUUUUACAUCGUCUAACAUA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 83 (5′ UGUUAGACGAUGUAAAAAUA 3′);

ix) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 23 (5′ UAAAAUUUUUACAUCGUCUAAC 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 84 (5′ UAGACGAUGUAAAAAUUUUA 3′);

x) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 29 (5′ UAUUUUUGACUUGUAGUUUAUA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 90 (5′ UAAACUACAAGUCAAAAAUA 3′);

xi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 31 (5′ UAUUAAGUUAGUUAGUUGCUCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 92 (5′ AGCAACUAACUAACUUAAUA 3′);

xii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 34 (5′ UUUAGUUAGUUGCUCUUCUAAA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 95 (5′ UAGAAGAGCAACUAACUAAA 3′);

xiii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 36 (5′ UAUGCUAUUAUCUUGUUUUUCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 97 (5′ AAAAACAAGAUAAUAGCAUA 3′);

xiv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 45 (5′ UAUAUAAUGUUUGUUGUCUUUC 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 106 (5′ AAGACAACAAACAUUAUAUA 3′);

xvi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 46 (5′ UAAAGAAUAUUCAAUAUAAUGU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 107 (5′ AUUAUAUUGAAUAUUCUUUA 3′).

36 . (canceled)

37 . The isolated oligonucleotide of claim 1 , wherein the double stranded region comprises:

i) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 4 (5′ UAUAAAAAGACUGAUCAAAUAU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 65 (5′ AUUUGAUCAGUCUUUUUAUA 3′);

ii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 10 (5′ UUAAUGUUUGUUGUCUUUCCAG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 71 (5′ GGAAAGACAACAAACAUUAA 3′);

iii) anti-sense strand of nucleotide sequence according to SEQ ID NO: 12 (5′ UUUUAUAGAGUAUAACCUUCCA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 73 (5′ GAAGGUUAUACUCUAUAAAA 3′);

iv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 16 (5′ UAAUAAAAAGAAGGAGCUUAAU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 77 (5′ UAAGCUCCUUCUUUUUAUUA 3′);

v) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 24 (5′ UGAUAGAUCAUAAAAAGACUGA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 85 (5′ AGUCUUUUUAUGAUCUAUCA 3′);

vi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 27 (5′ UUAGUUUAUAUGUAGUUCUUCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 88 (5′ AAGAACUACAUAUAAACUAA 3′);

vii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 30 (5′ UUUAAGUUAGUUAGUUGCUCUU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 91 (5′ GAGCAACUAACUAACUUAAA 3′);

viii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 32 (5′ UUUGAUUUUGAAUUAAGUUAGU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 93 (5′ UAACUUAAUUCAAAAUCAAA 3′);

ix) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 35 (5′ UCUAUUAUCUUGUUUUUCUACA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 96 (5′ UAGAAAAACAAGAUAAUAGA 3′);

x) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 37 (5′ UAAGAUAGAGAAAUUUCUGUGG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 98 (5′ ACAGAAAUUUCUCUAUCUUA 3′);

xi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 38 (5′ UGAGAAAUUUCUGUGGGUUCUU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 99 (5′ GAACCCACAGAAAUUUCUCA 3′);

xii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 39 (5′ UCUGAAGAAAGGGAGUAGUUCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 100 (5′ AACUACUCCCUUUCUUCAGA 3′);

xiii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 41 (5′ UUUGAAUUAAUGUCCAUGGACU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 102 (5′ UCCAUGGACAUUAAUUCAAA 3′);

xiv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 42 (5′ UAAACCAUAUUUGUAGUUCUCC 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 103 (5′ AGAACUACAAAUAUGGUUUA 3′);

xv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 44 (5′ UUAUAAUGUUUGUUGUCUUUCC 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 105 (5′ AAAGACAACAAACAUUAUAA 3′);

xvii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 48 (5′ UUUUACAUCGUCUAACAUAGCA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 109 (5′ CUAUGUUAGACGAUGUAAAA 3′);

xviii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 49 (5′ UUUUUACAUCGUCUAACAUAGC 3′), and an anti-sense strand of nucleotide sequence according to SEQ ID NO: 110 (5′ UAUGUUAGACGAUGUAAAAA 3′);

xix) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 52 (5′ UCAAAUAUGUUGAGUUUUUGAA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 113 (5′ CAAAAACUCAACAUAUUUGA 3′);

xx) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 53 (5′ UAUGUAGUUCUUCUCAGUUCCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 114 (5′ GAACUGAGAAGAACUACAUA 3′);

xxi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 56 (5′ UUUGAGUUGAGUUCAAGUGACA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 117 (5′ UCACUUGAACUCAACUCAAA 3′);

xxii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 60 (5′ UUUGUUGAAGUAGAAUUUUUUC 3′), and an anti-sense strand of nucleotide sequence according to SEQ ID NO: 121 (5′ AAAAAUUCUACUUCAACAAA 3′);

xxiii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 61 (5′ UUUCACUUUUUGUUGAAGUAGA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 122 (5′ UACUUCAACAAAAAGUGAAA 3′);

xxiv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 19 (5′ UCAUAGCAAAUCUUGAUUUUGG 3′), and an anti-sense strand of nucleotide sequence according to SEQ ID NO: 80 (5′ AAAAUCAAGAUUUGCUAUGA 3′); or

xxv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 58 (5′ UGAAUUAAGUUAGUUAGUUGCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 119 (5′ CAACUAACUAACUUAAUUCA 3′).

38 . (canceled)

39 . The isolated oligonucleotide of claim 1 , wherein the double stranded region comprises:

ii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 3 (5′ UAAAUUUUUACAUCGUCUAACA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 64 (5′ UUAGACGAUGUAAAAAUUUA 3′);

iii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 6 (5′ UUUUAAGUGAAGUUACUUCUGG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 67 (5′ AGAAGUAACUUCACUUAAAA 3′);

vi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 11 (5′ UGUAUAACCUUCCAUUUUGAGA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 72 (5′ UCAAAAUGGAAGGUUAUACA 3′);

vii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 13 (5′ UUUGAUUUUAUAGAGUAUAACC 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 74 (5′ UUAUACUCUAUAAAAUCAAA 3′);

ix) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 15 (5′ UAUAAAAAGAAGGAGCUUAAUU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 76 (5′ UUAAGCUCCUUCUUUUUAUA 3′);

xi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 18 (5′ UAAAUCUUGAUUUUGGCUCUGG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 79 (5′ AGAGCCAAAAUCAAGAUUUA 3′);

xiv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 22 (5′ UAUUUUUACAUCGUCUAACAUA 3′), and an anti-sense strand of nucleotide sequence according to SEQ ID NO: 83 (5′ UGUUAGACGAUGUAAAAAUA 3′);

xvi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 25 (5′ UUAAAAAGACUGAUCAAAUAUG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 86 (5′ UAUUUGAUCAGUCUUUUUAA 3′);

xvii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 26 (5′ UAUAGAUCAUAAAAAGACUGAU 3′), and an anti-sense strand of nucleotide sequence according to SEQ ID NO: 87 (5′ CAGUCUUUUUAUGAUCUAUA 3′);

xviii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 29 (5′ UAUUUUUGACUUGUAGUUUAUA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 90 (5′ UAAACUACAAGUCAAAAAUA 3′);

xix) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 31 (5′ UAUUAAGUUAGUUAGUUGCUCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 92 (5′ AGCAACUAACUAACUUAAUA 3′);

xx) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 33 (5′ UUUCUAAAUAUUUCACUUUUUG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 94 (5′ AAAAGUGAAAUAUUUAGAAA 3′);

xxi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 34 (5′ UUUAGUUAGUUGCUCUUCUAAA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 95 (5′ UAGAAGAGCAACUAACUAAA 3′);

xxii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 36 (5′ UAUGCUAUUAUCUUGUUUUUCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 97 (5′ AAAAACAAGAUAAUAGCAUA 3′);

xxiii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 40 (5′ UAAAACUUGAGAGUUGCUGGGU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 101 (5′ CCAGCAACUCUCAAGUUUUA 3′);

xxiv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 43 (5′ UUAAUUAGAUUGCUUCACUAUG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 104 (5′ UAGUGAAGCAAUCUAAUUAA 3′);

xxv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 45 (5′ UAUAUAAUGUUUGUUGUCUUUC 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 106 (5′ AAGACAACAAACAUUAUAUA 3′);

xxvi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 47 (5′ UAAAAAGAAGGAGCUUAAUUGU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 108 (5′ AAUUAAGCUCCUUCUUUUUA 3′);

xxvii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 50 (5′ UCUAACAUAGCAAAUCUUGAUU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 111 (5′ UCAAGAUUUGCUAUGUUAGA 3′);

xxviii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 51 (5′ UUUGAAAUAUGUCAUUAAUUUG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 112 (5′ AAUUAAUGACAUAUUUCAAA 3′);

xxix) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 54 (5′ UUUAUAUGUAGUUCUUCUCAGU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 115 (5′ UGAGAAGAACUACAUAUAAA 3′);

xxx) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 55 (5′ UCAAGUGACAUAUUCUUUACCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 116 (5′ GUAAAGAAUAUGUCACUUGA 3′);

xxxi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 57 (5′ UAAGUUAGUUAGUUGCUCUUCU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 118 (5′ AAGAGCAACUAACUAACUUA 3′);

xxxii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 5 (5′ UGACAUAUUCUUUACCUCUUCA 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 66 (5′ AAGAGGUAAAGAAUAUGUCA 3′);

xxxiii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 59 (5′ UGUUGAAGUAGAAUUUUUUCUU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 120 (5′ GAAAAAAUUCUACUUCAACA 3′);

xxxiv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 62 (5′ UUUUAUUUGACUAUGCUGUUGG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 123 (5′ AACAGCAUAGUCAAAUAAAA 3′);

xxxv) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 7 (5′ UUUUUAAGUGAAGUUACUUCUG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 68 (5′ GAAGUAACUUCACUUAAAAA3′);

xxxvi) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 28 (5′ UUUUAUAUGUAGUUCUUCUCAG 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 89 (5′ GAGAAGAACUACAUAUAAAA 3′); or

xxxvii) an anti-sense strand of nucleotide sequence according to SEQ ID NO: 200 (5′ UUUCAAAGCUUUCUGAAUCUGU 3′), and a sense strand of nucleotide sequence according to SEQ ID NO: 235 (5′ AGAUUCAGAAAGCUUUGAAA 3′).

40 . The isolated oligonucleotide of claim 1 , wherein the sense strand or the anti-sense strand or both comprise one or more modified nucleotide(s).

41 . (canceled)

42 . A vector encoding the isolated oligonucleotide of claim 1 .

43 . (canceled)

44 . A delivery system comprising the isolated oligonucleotide of claim 1 .

45 .- 46 . (canceled)

47 . A pharmaceutical composition comprising the isolated oligonucleotide of claim 1 , and a pharmaceutically acceptable carrier, diluent or excipient.

48 . A kit comprising the isolated oligonucleotide of claim 1 .

49 . (canceled)

50 . A method of inhibiting or downregulating the expression or level of ANGPTL-3 in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of the isolated oligonucleotide of claim 1 .

51 . A method of treating or preventing a disease or disorder associated with aberrant or increased expression or activity of ANGPTL-3 or a disease or disorder where ANGPTL-3 plays a role in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of the isolated oligonucleotide of claim 1 .

Assignments (2)

ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Dec 18, 2025

From: SANEGENE BIO INC.

To: SANEGENE BIO USA INC.

Reel/Frame 073966/0761 →

ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Jan 26, 2023

From: ZHANG, CHUNYANG; WANG, SHIYU; CAI, XIAOCHUAN; WANG, WEIMIN; YANG, ZHONGFA

To: SANEGENE BIO USA INC.

Reel/Frame 062498/0733 →