OLIGONUCLEOTIDE COMPOSITIONS AND METHODS OF USE THEREOF
Among other things, the present disclosure provides designed PNPLA3 oligonucleotides, compositions, and methods thereof. In some embodiments, provided oligonucleotide compositions provide improved single-stranded RNA interference and/or RNase H-mediated knockdown. Among other things, the present disclosure encompasses the recognition that structural elements of oligonucleotides, such as base sequence, chemical modifications (e.g., modifications of sugar, base, and/or internucleotidic linkages) or patterns thereof, conjugation with additional chemical moieties, and/or stereochemistry [e.g., stereochemistry of backbone chiral centers (chiral internucleotidic linkages)], and/or patterns thereof, can have significant impact on oligonucleotide properties and activities, e.g., RNA interference (RNAi) activity, stability, delivery, etc. In some embodiments, the present disclosure provides methods for treatment of diseases using provided oligonucleotide compositions, for example, in RNA interference and/or RNase H-mediated knockdown.
1 .- 85 . (canceled)
86 . A composition comprising oligonucleotides of a particular oligonucleotide type characterized by:
a) a common base sequence;
b) a common pattern of backbone linkages;
c) a common pattern of backbone chiral centers;
wherein the oligonucleotide comprises at least one internucleotidic linkage comprising a linkage phosphorus in the Sp configuration;
wherein the composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same common base sequence, for oligonucleotides of the particular oligonucleotide type; and
wherein the common base sequence has over 50% identity with TGCCACUGUAGAAAGGCATGATU (SEQ ID NO: 696), wherein each U is optionally and independently replaced with T and vice versa.
87 . The composition of claim 86 , wherein oligonucleotides of the plurality share:
the same linkage phosphorus stereochemistry independently at five or more chiral internucleotidic linkages (“chirally controlled internucleotidic linkages”);
wherein about 10% of all oligonucleotides in the composition that share the common base sequence are oligonucleotides of the plurality; and
wherein the common base sequence is complementary to a portion of the base sequence of an PNPLA3 transcript, wherein the portion comprises 15 or more nucleobases.
88 . The composition of claim 87 , wherein oligonucleotides of the plurality share the same linkage phosphorus stereochemistry independently at five or more chiral internucleotidic linkages, and about 50%-100% of all oligonucleotides in the composition that share the common base sequence are oligonucleotides of the plurality.
89 . The composition of claim 87 , wherein oligonucleotides of the plurality share the same linkage phosphorus stereochemistry independently at each phosphorothioate internucleotidic linkage.
90 . The composition of claim 87 , wherein oligonucleotides of the plurality are of the same constitution.
91 . The composition of claim 89 , wherein the composition is a liquid composition.
92 . The composition of claim 87 , wherein oligonucleotides of the plurality each independently comprise a targeting moiety (R CD ).
93 . The composition of claim 92 , wherein R CD is
94 . The composition of claim 92 , wherein R CD is connected to the oligonucleotide or oligonucleotides through a linker.
95 . The composition of claim 94 , wherein the linker has the structure of
96 . The composition of claim 94 , wherein R CD is selected from:
97 . The composition of claim 86 , wherein the common base sequence has over 60% identity with TGCCACUGUAGAAAGGCATGATU (SEQ ID NO: 696), wherein each U is optionally and independently replaced with T and vice versa.
98 . The composition of claim 86 , wherein the common base sequence has over 70% identity with TGCCACUGUAGAAAGGCATGATU (SEQ ID NO: 696), wherein each U is optionally and independently replaced with T and vice versa.
99 . The composition of claim 86 , wherein the common base sequence has over 80% identity with TGCCACUGUAGAAAGGCATGATU (SEQ ID NO: 696), wherein each U is optionally and independently replaced with T and vice versa.
100 . A composition comprising oligonucleotides of a particular oligonucleotide type characterized by:
a) a common base sequence;
b) a common pattern of backbone linkages;
c) a common pattern of backbone chiral centers;
wherein the oligonucleotide comprises at least one internucleotidic linkage comprising a linkage phosphorus in the Sp configuration;
wherein the composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same common base sequence, for oligonucleotides of the particular oligonucleotide type; and
wherein the common base sequence has over 50% identity with GGACCTGAGGATGGACCGCG (SEQ ID NO: 717), wherein each U is optionally and independently replaced with T and vice versa.
101 . The composition of claim 100 , wherein oligonucleotides of the plurality share:
the same linkage phosphorus stereochemistry independently at five or more chiral internucleotidic linkages (“chirally controlled internucleotidic linkages”);
wherein about 10% of all oligonucleotides in the composition that share the common base sequence are oligonucleotides of the plurality; and
wherein the common base sequence is complementary to a portion of the base sequence of an PNPLA3 transcript, wherein the portion comprises 15 or more nucleobases.
102 . A method for treating fatty liver, nonalcoholic fatty liver disease, nonalcoholic steatohepatitis, nonalcoholic steatohepatitis with liver fibrosis, nonalcoholic steatohepatitis with cirrhosis, or nonalcoholic steatohepatitis with cirrhosis and hepatocellular carcinoma in humans comprising the step of administering to a human in need of such treatment a therapeutically effective amount of a composition of claim 86 , wherein the human has I148M mutation in a PNPLA3 allele.
103 . A method for treating fatty liver, nonalcoholic fatty liver disease, nonalcoholic steatohepatitis, nonalcoholic steatohepatitis with liver fibrosis, nonalcoholic steatohepatitis with cirrhosis, or nonalcoholic steatohepatitis with cirrhosis and hepatocellular carcinoma in humans comprising the step of administering to a human in need of such treatment a therapeutically effective amount of a composition of claim 100 .
104 . A method for selectively reducing expression from a mutant PNPLA3 allele over a wild-type allele, wherein the mutant PNPLA3 allele comprises I148M, comprising contacting transcripts from the mutant PNPLA3 allele with a composition of claim 86 .