IMPROVED DETECTION OF GENOMIC SEQUENCES AND PROBE MOLECULES THEREFOR
Methods of identifying homologous genomic sequences that may be present in a sample utilizing virtual probes, arrays for distinguishing homologous genomic sequences, systems for distinguishing homologous genomic sequences, and probe molecules useful in the methods, arrays, and systems of the disclosure.
1 . A method of detecting if a first microorganism having a first genome or a second microorganism of the same genus having a second genome is present in a test sample or an initial sample from which the test sample was prepared, comprising:
(a) probing the test sample with a virtual probe comprising a plurality of probe molecules, wherein:
(i) the virtual probe comprises at least two probe molecules each capable of specifically hybridizing to one or more target nucleic acids corresponding to the first genome and/or one or more homologous target nucleic acids corresponding to the second genome,
(ii) at least one of the probe molecules is a meter probe capable of hybridizing to a target nucleic acid corresponding to the first genome and a homologous target nucleic acid corresponding to the second genome, such that the hybridizing of the meter probe to such target nucleic acids can provide a measure of the relative amount of target nucleic acids in the test sample,
(iii) the probe molecules of the virtual probe cannot individually distinguish the target nucleic acids corresponding to the first and second genomes, and
(iv) the probe molecules hybridize non-identically to the target nucleic acids corresponding to the first and second genomes, such that the hybridizing of the probe molecules to the target nucleic acids corresponding to the first and second genomes can distinguish between the target nucleic acids corresponding to the first and second genomes;
(b) detecting and/or quantifying signals from hybridization of the probe molecules in the virtual probe to nucleic acids, if any, in the test sample; and
(c) if hybridization of the probe molecules to nucleic acids in the test sample is detected, then:
(i) analyzing the signals detected and/or quantified in step (b) according to a first formula if the signal from hybridization of the meter probe to nucleic acids in the sample is greater than or equal to a threshold value, and
(ii) analyzing the signals detected and/or quantified in step (b) according to a second formula if the signal from hybridization of the meter probe to nucleic acids in the sample is less than the threshold value.
2 . The method of claim 1 , wherein the signal from hybridization of the meter probe to nucleic acids in the sample is a raw signal.
3 . The method of claim 1 , wherein the signal from hybridization of the meter probe to nucleic acids in the sample is a normalized signal.
4 . The method of any one of claims 1 to 3 , wherein the meter probe is a genus probe.
5 . The method of any one of claims 1 to 4 , wherein the one or more target nucleic acids corresponding to the first genome are a first amplicon set and the one or more target nucleic acids corresponding to the second genome are a second amplicon set, and wherein each probe molecule in the virtual probe is capable of specifically hybridizing to one or more amplicons in the first amplicon set and/or the second amplicon set, and wherein the probe molecules hybridize non-identically to the amplicons in the first amplicon set and the amplicons in the second amplicon set, such that the hybridizing of the probe molecules to the amplicons in the first amplicon set and the second amplicon set can distinguish between the first amplicon set and the second amplicon set.
6 . The method of claim 5 , which further comprises preparing the test sample by performing a PCR amplification reaction on the initial sample using PCR primers capable of hybridizing to, and initiating a PCR amplification from, both the first genome and the second genome, resulting in the first amplicon set and a second amplicon set, respectively, when the first genome and second genome are present in the initial sample.
7 . The method of any one of claims 1 to 6 , wherein the probe molecules of the virtual probe are positionally addressable probe molecules present on an array, each at a discrete location on the array.
8 . The method of claim 7 , wherein step (b) comprises:
(i) contacting PCR amplification products with the array;
(ii) washing unbound nucleic acid molecules from the array; and
(iii) measuring the signal intensity of a label at each probe molecule location on the array.
9 . The method of any one of claims 5 to 8 , wherein the first amplicon set and the second amplicon set each comprise a nucleotide sequence corresponding to a gene encoding rRNA.
10 . The method of any one of claims 5 to 9 , wherein the first amplicon set and the second amplicon set each comprise a nucleotide sequence corresponding to an intergenic spacer region between rRNA genes.
11 . The method of any one of claims 1 to 10 , wherein the first and second microorganisms are members of the same group.
12 . The method of any one of claims 1 to 11 , wherein one or more of the microorganisms is a human pathogen or an animal pathogen.
13 . The method of any one of claims 11 to 12 , wherein the microorganisms are bacteria, viruses, or fungi.
14 . The method of any one of claims 11 to 13 , wherein the microorganisms are bacteria.
15 . The method of claim 14 , wherein the first amplicon set and the second amplicon set each comprise a nucleotide sequence corresponding to a 16S rRNA gene and/or a nucleotide sequence corresponding to a 23S rRNA gene.
16 . The method of claim 15 , wherein the first amplicon set and the second amplicon set each comprise a nucleotide sequence corresponding to a 16S rRNA gene.
17 . The method any one of claims 1 to 16 , wherein the first formula combines signals from the hybridization of the probe molecules to target nucleic acids by (i) one or more Boolean operators, (ii) one or more relational operators, (iii) one or more signal ratios or (iv) any combination of (i)-(iii).
18 . The method of any one of claims 1 to 17 , wherein the second formula combines signals from the hybridization of the probe molecules to target nucleic acids by (i) one or more Boolean operators, (ii) one or more relational operators, (iii) one or more signal ratios or (iv) any combination of (i)-(iii).
19 . The method of any one of claims 1 to 18 , wherein the virtual probe comprises or consists of two probe molecules.
20 . The method of any one of claims 1 to 19 , wherein the first microorganism is a coagulase negative Staphylococcus sp. (CNS) and the second microorganism is a coagulase positive Staphylococcus sp. (CPS).
21 . The method of claim 20 , wherein the second microorganism is S. aureus.
22 . The method of any one of claim 20 or claim 21 , wherein the virtual probe comprises a probe molecule having a nucleotide sequence comprising CCAGTCTTATAGGTAGGTTAYCCACG (SEQ ID NO:1).
23 . The method of claim 22 , wherein the probe molecule having a nucleotide sequence comprising CCAGTCTTATAGGTAGGTTAYCCACG (SEQ ID NO:1) is a meter probe.
24 . The method of any one of claims 20 to 23 , wherein the virtual probe comprises a probe molecule having a nucleotide sequence comprising GCTTCTCGTCCGTTCGCTCG (SEQ ID NO:2).
25 . The method of claim 24 , wherein the virtual probe comprises a first probe molecule having a nucleotide sequence comprising CCAGTCTTATAGGTAGGTTAYCCACG (SEQ ID NO:1) and a second probe molecule having a nucleotide sequence comprising GCTTCTCGTCCGTTCGCTCG (SEQ ID NO:2), wherein the first formula and second formula combines signals from the first probe and the second probe in a signal ratio.
26 . The method of claim 25 , wherein the first formula and the second formula each compares the signal ratio to a predetermined cutoff value, wherein the cutoff value of the first formula and the cutoff value of the second formula are different.
27 . The method of claim 26 , which comprises determining that CNS is present in the sample when the signal ratio is greater than or equal to the cutoff value of the first formula when the signal from hybridization of the meter probe to nucleic acids in the sample is greater than or equal to the threshold value.
28 . The method of claim 26 or claim 27 , which comprises determining that CNS is present in the sample when the signal ratio is greater than the cutoff value of the second formula when the signal from hybridization of the meter probe to nucleic acids in the sample is less than the threshold value.
29 . The method of any one of claims 26 to 28 , which comprises determining that CPS is present in the sample when the signal ratio is less than the cutoff value of the first formula when the signal from hybridization of the meter probe to nucleic acids in the sample is greater than or equal to the threshold value.
30 . The method of any one of claims 26 to 29 , which comprises determining that CPS is present in the sample when the signal ratio is less than or equal to the cutoff value of the second formula when the signal from hybridization of the meter probe to nucleic acids in the sample is less than the threshold value.
31 . The method of any one of claims 1 to 30 , wherein the initial sample or test sample is a biological sample, an environmental sample, or a food product.
32 . The method of claim 31 , wherein the sample is blood or a sample processed, extracted or fractionated from blood
33 . The method of any one of claims 1 to 32 , wherein step (c) is computer-implemented and wherein step (c) comprises executing, in a computer system having one or more processors coupled to a memory storing one or more computer readable instructions for execution by the one or more processors, the one or more computer readable instructions comprising instructions for: (i) receiving signal data from hybridization of the probe molecules in the virtual probe to nucleic acids, if any, in the test sample and (ii) analyzing the signal data according to the first formula if the signal data from hybridization of the meter probe to nucleic acids in the sample is greater than or equal to a threshold value and analyzing the signal data according to the second formula if the signal from hybridization of the meter probe to nucleic acids in the sample is less than the threshold value.
34 . The method of claim 33 , further comprising providing a notification to a user, wherein the notification optionally concerns the presence or absence of the first microorganism and/or second microorganism in the test sample.
35 . An addressable array, comprising:
(a) one or more virtual probes for distinguishing a first genomic sequence from a second, homologous genomic sequence, each virtual probe comprising a group of positionally addressable oligonucleotide probe molecules, each at a discrete location on the array, wherein each probe molecule in the one or more virtual probes comprises a nucleotide sequence that is 90% to 100% complementary to 15 to 40 consecutive nucleotides in the first genomic sequence or second genomic sequence, wherein one or more of the oligonucleotide probe molecules are meter probes; and
(b) optionally, one or more control probe molecules.
36 . A method of detecting if a first microorganism having a first genome or a second microorganism of the same genus having a second genome is present in a test sample or an initial sample from which the test sample is derived, comprising:
(a) probing the test sample with an array according to claim 35 which comprises a virtual probe comprising two or more probe molecules, wherein:
(i) each probe molecule is capable of specifically hybridizing to one or more target nucleic acids corresponding to the first genome and/or one or more homologous target nucleic acids corresponding to the second genome,
(ii) at least one of the probe molecules of the virtual probe is a meter probe capable of hybridizing to a target nucleic acid corresponding to the first genome and a homologous target nucleic acid corresponding to the second genome, such that the hybridizing of the meter probe to such target nucleic acids can provide a measure of the relative amount of target nucleic acids in the test sample,
(iii) the probe molecules of the virtual probe cannot individually distinguish the target nucleic acids corresponding to the first and second genomes; and
(iv) the probe molecules hybridize non-identically to the target nucleic acids corresponding to the first and second genomes, such that the hybridizing of the probe molecules to the one or more target nucleic acids corresponding to the first and second genomes can distinguish between the target nucleic acids corresponding to the first and second genomes;
(b) washing unbound nucleic acid molecules from the array;
(c) detecting and/or quantifying the signal at each probe molecule location on the array; and
(d) if the signals indicate that:
(i) target nucleic acids that hybridize to the probe molecules of the array are present in the test sample, analyzing the signals to determine if target nucleic acids corresponding to the first genome or target nucleic acids corresponding to the second genome are present in the sample, thereby determining if the first organism or second organism are present in the initial sample or the test sample; or
(ii) no target products that hybridize to the probe molecules of the virtual probe are produced in step (a), determining that that initial sample or test sample does not contain the first organism or the second organism.
37 . The method of claim 36 , wherein the analyzing of step (d)(i) comprises (i) analyzing the signals detected and/or quantified in step (c) according to a first formula if the signal from the meter probe is greater than or equal to a threshold value, and (ii) analyzing the signals detected and/or quantified in step (c) according to a second formula if the signal from the meter probe is less than the threshold value
38 . The method of claim 36 or claim 37 , wherein the one or more target nucleic acids corresponding to the first genome are a first amplicon set and the one or more target nucleic acids corresponding to the second genome are a second amplicon set, and wherein each probe molecule in the virtual probe is capable of specifically hybridizing to one or more amplicons in the first amplicon set and/or the second amplicon set, and wherein the probe molecules hybridize non-identically to the amplicons in the first amplicon set and the amplicons in the second amplicon set, such that the hybridizing of the probe molecules to the amplicons in the first amplicon set and the second amplicon set can distinguish between the first amplicon set and the second amplicon set.
39 . The method of claim 38 , which further comprises preparing the test sample by performing a PCR amplification reaction on the initial sample using PCR primers capable of hybridizing to, and initiating a PCR amplification from, both the first genome and the second genome, resulting in the first amplicon set and a second amplicon set, respectively, when the first genome and second genome are present in the sample.
40 . The method of any one of claims 36 to 39 , wherein step (d) is computer-implemented and wherein step (d) comprises executing, in a computer system having one or more processors coupled to a memory storing one or more computer readable instructions for execution by the one or more processors, the one or more computer readable instructions comprising instructions for: (i) receiving signal data from hybridization of the probe molecules in the virtual probe to nucleic acids, if any, in the test sample and (ii) analyzing the signal data according to the first formula if the signal data from hybridization of the meter probe to nucleic acids in the sample is greater than or equal to a threshold value and analyzing the signal data according to the second formula if the signal from hybridization of the meter probe to nucleic acids in the sample is less than the threshold value.
41 . The method of claim 40 , further comprising providing a notification to a user, wherein the notification optionally concerns the presence or absence of the first microorganism and/or second microorganism in the test sample.
42 . A system, comprising:
(a) an optical reader for generating signal data for each probe molecule location of the array of claim 35 ; and
(b) one or more processors, wherein:
(i) at least one of the processors is configured to receive signal data from the optical reader;
(ii) at least one of the processors is configured to analyze signal data for the one or more virtual probes generated following hybridization of the probe molecules in the virtual probes to nucleic acid molecules, if present, in a test sample, optionally wherein the analysis comprises determining whether the test sample contains the first genomic sequence and/or the second genomic sequence; and
(iii) at least one of the processors has an interface to a storage or display device or network for outputting a result of the analysis.
43 . The system of claim 42 , which comprises a light source capable of exciting fluorescently labeled molecules on the array.
44 . The system of claim 42 or claim 43 , further comprising a plate handling robot capable of adding the product of a PCR amplification reaction to the array and capable of washing unbound nucleic acid molecules from the array.
45 . A method for preparing a test sample for detecting if a first microorganism having a first genome or a second microorganism of the same genus having a second genome is present in an initial sample, comprising:
(a) performing a PCR amplification reaction on the initial sample using PCR primers capable of hybridizing to, and initiating a PCR amplification from, both the first genome and the second genome, resulting in a first amplicon set and a second amplicon set, respectively, when the first genome and second genome are present in the initial sample;
(b) contacting the PCR amplification product of step (a) with an array according to claim 35 comprising a virtual probe for distinguishing a first genomic sequence of the first microorganism from a second, homologous genomic sequence of the second microorganism, wherein the virtual probe comprises a meter probe; and
(c) washing unbound nucleic acid molecules from the array.
46 . The method of claim 45 , further comprising
(f) detecting and/or quantifying the signal at each probe molecule location on the array; and
(g) if hybridization of the probe molecules to nucleic acids in the test sample is detected, then:
(i) analyzing the signals detected and/or quantified in step (d) according to a first formula if the signal from the meter probe is greater than or equal to a threshold value, and
(ii) analyzing the signals detected and/or quantified in step (d) according to a second formula if the signal from the meter probe is less than the threshold value.