DOUBLE STRANDED RNA TARGETING 17-BETA HYDROXYSTEROIDDEHYDROGENASE 13 (HSD17B13) AND METHODS OF USE THEREOF

1 . An isolated oligonucleotide comprising a sense strand and an antisense strand, wherein:

the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising 19-25 nucleotides between any one of the nucleotide positions selected from:

a) 229 to 249;

b) 344 to 364;

c) 474 to 496;

d) 669 to 741;

e) 882 to 947;

f) 999 to 1032;

g) 1101 to 1216;

h) 1297 to 1326; and

i) 1421 to 1507,

from the 5′ end of a hydroxysteroid 17-beta dehydrogenase 13 (HSD17B13) mRNA sequence according to SEQ ID NO: 1,

and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double stranded region.

2 . (canceled)

3 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a nucleotide sequence that is substantially identical to a region between any one of the nucleotide positions selected from:

a) 927 to 947;

b) 1007 to 1032;

c) 1194 to 1216; and

d) 1421 to 1445,

from the 5′ end of a HSD17B13 mRNA sequence according to SEQ ID NO: 1.

4 . (canceled)

5 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a nucleotide sequence that is substantially identical to a region between any one of the nucleotide positions selected from:

a) 344 to 364;

b) 476 to 496;

c) 669 to 741;

d) 882 to 915;

e) 999 to 1030;

f) 1101 to 1121;

g) 1297 to 1326; and

h) 1487 to 1507,

from the 5′ end of a HSD17B13 mRNA sequence according to SEQ ID NO: 1.

6 . (canceled)

7 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a sequence that is substantially identical to a region comprising the sequence between any one of the nucleotide positions selected from:

a) 229 to 249; and

b) 474 to 494,

from the 5′ end of a HSD17B13 mRNA sequence according to SEQ ID NO: 1.

8 .- 12 . (canceled)

13 . The isolated oligonucleotide of claim 3 , wherein the double stranded region comprises:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 2 (5′ UUAUUCAUUUCAUUUUGAUUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 31 (5′ AAUCAAAAUGAAAUGAAUAA 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 3 (5′ UAAUGUGAAAUAAAGCUUUGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 32 (5′ CAAAGCUUUAUUUCACAUUA 3′);

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 4 (5′ UGAAAAAAUGUGAAAUAAAGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 33 (5′ CUUUAUUUCACAUUUUUUCA 3′);

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 5 (5′ UAUCUUAAAGAAAACCUUUUAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 34 (5′ AAAAGGUUUUCUUUAAGAUA 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 6 (5′ UAUAUCUUAAAGAAAACCUUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 35 (5′ AAGGUUUUCUUUAAGAUAUA 3′);

vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 7 (5′ UUUUCAAAUGCUGAAUCUUAAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 36 (5′ UAAGAUUCAGCAUUUGAAAA 3′);

vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 8 (5′ UAUCUUUCAAAUGCUGAAUCUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 37 (5′ GAUUCAGCAUUUGAAAGAUA 3′); or

viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 9 (5′ UAAUCUUUCAAAUGCUGAAUCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 38 (5′ AUUCAGCAUUUGAAAGAUUA 3′).

14 . The isolated oligonucleotide of claim 5 , wherein the double stranded region comprises:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 10 (5′ UUUCACCUGAUUUAGAGAGCGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 39 (5′ GCUCUCUAAAUCAGGUGAAA 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 11 (5′ UGUGAUCCAAAAAUGUCCUAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 40 (5′ UAGGACAUUUUUGGAUCACA 3′);

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 12 (5′ UGAGACAUGAGGUUUUGAUACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 41 (5′ UAUCAAAACCUCAUGUCUCA 3′);

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 13 (5′ UAUAAUCUUGUGCUUGGAUUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 42 (5′ AAUCCAAGCACAAGAUUAUA 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 14 (5′ UAAUAUUCUGCAUACGAUUUAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 43 (5′ AAAUCGUAUGCAGAAUAUUA 3′);

vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 15 (5′ UAAAUUGAAUAUUCUGCAUACG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 44 (5′ UAUGCAGAAUAUUCAAUUUA 3′);

vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 16 (5′ UUUCAAAUUGAAUAUUCUGCAU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 45 (5′ GCAGAAUAUUCAAUUUGAAA 3′);

viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 17 (5′ UCUGCUUCAAAUUGAAUAUUCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 46 (5′ AAUAUUCAAUUUGAAGCAGA 3′);

ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 18 (5′ UAUAAAGCUUUGCAGCAUUGAU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 47 (5′ CAAUGCUGCAAAGCUUUAUA 3′);

x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 19 (5′ UAAUAAAGCUUUGCAGCAUUGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 48 (5′ AAUGCUGCAAAGCUUUAUUA 3′);

xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 20 (5′ UGUGAAAUAAAGCUUUGCAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 49 (5′ CUGCAAAGCUUUAUUUCACA 3′);

xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 21 (5′ UAAAUGUGAAAUAAAGCUUUGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 50 (5′ AAAGCUUUAUUUCACAUUUA 3′);

xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 22 (5′ UAAAAUGUGAAAUAAAGCUUUG3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 51 (5′ AAGCUUUAUUUCACAUUUUA 3′);

xiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 23 (5′ UAAAAAUGUGAAAUAAAGCUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 52 (5′ AGCUUUAUUUCACAUUUUUA 3′);

xv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 24 (5′ UUAUUCUUGAGAAACAGGAAGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 53 (5′ UUCCUGUUUCUCAAGAAUAA 3′);

xvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 25 (5′ UAUGCUACUUGAACAGUCUUAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 54 (5′ AAGACUGUUCAAGUAGCAUA 3′);

xviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 26 (5′ UUUGGAAUGCUACUUGAACAGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 55 (5′ UGUUCAAGUAGCAUUCCAAA3′);

xix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 27 (5′ UCAGAUUGGAAUGCUACUUGAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 56 (5′ CAAGUAGCAUUCCAAUCUGA 3′); or

xx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 28 (5′ UGUAAUAAAGUCCAGAAUAGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 57 (5′ CUAUUCUGGACUUUAUUACA 3′).

15 . The isolated oligonucleotide of claim 7 , wherein the double stranded region comprises:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 29 (5′ UUAUUAAUAUCCCACAGAACCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 58 (5′ GUUCUGUGGGAUAUUAAUAA 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 30 (5′ UGAUCCAAAAAUGUCCUAGGAU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 59 (5′ CCUAGGACAUUUUUGGAUCA 3′); or

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 30 (5′ UGAUCCAAAAAUGUCCUAGGAU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO:60 (5′ CCUAGGACAUUUUUGIAUCA 3′).

16 . (canceled)

17 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a nucleotide sequence that is identical to a region between any one of the nucleotide positions selected from:

a) 229 to 249;

b) 669 to 689; and

c) 1007 to 1027,

from the 5′ end of a HSD17B13 mRNA sequence according to SEQ ID NO: 1.

18 . The isolated oligonucleotide of claim 17 , wherein the antisense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 3, 12 and 29.

19 . The isolated oligonucleotide of claim 17 , wherein the sense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 32, 41 and 58.

20 . The isolated oligonucleotide of claim 17 , wherein the double stranded region comprises an antisense strand of nucleic acid sequence according to SEQ ID NO: 3 (5′ UAAUGUGAAAUAAAGCUUUGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 32 (5′ CAAAGCUUUAUUUCACAUUA 3′).

21 . The isolated oligonucleotide of claim 17 , wherein the double stranded region comprises an antisense strand of nucleic acid sequence according to SEQ ID NO: 12 (5′ UGAGACAUGAGGUUUUGAUACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 41 (5′ UAUCAAAACCUCAUGUCUCA 3′).

22 . The isolated oligonucleotide of claim 17 , wherein the double stranded region comprises an antisense strand of nucleic acid sequence according to SEQ ID NO: 29 (5′ UUAUUAAUAUCCCACAGAACCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 58 (5′ GUUCUGUGGGAUAUUAAUAA 3′).

23 .- 26 . (canceled)

27 . The isolated oligonucleotide of claim 1 , wherein the antisense strand comprises nucleotides modified with 2′-F modification (“F”), and nucleotides modified with 2′-O-methyl modification (“M”), according to the formula:

3′(M) 0 (F) 0 (M) 6 (F) 1 (M) 1 (F) 1 (M) 3 (F) 1 (M) 2 (F) 1 (M) 1 (F) 1 (M) 1 (F) 2 (M) 1 5′.

28 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises nucleotides modified with 2′-F modification (“F”), and nucleotides modified with 2′-O-methyl modification (“M”), according to the formula:

5′(M) 0 (F) 0 (M) 5 (F) 1 (M) 1 (F) 4 (M) 9 3′.

29 . The isolated oligonucleotide of claim 1 , wherein the antisense strand comprises any one of:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 440 (5′ [McEPmUs][fAs][fA][mU][fG][mU][f 1][mA][mA][fA][mU][mA][mA][fA][mG][fC][mU][mU][mU][mGs][mCs][mA] 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 442 (5′ [McEPmUs][fGs][fA][mG][fA][mC][fA][mU][mG][fA][mG][mG][mU][fU][mU][fU][mG][mA][mU][mAs][mCs][mC] 3′); or

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 444 (5′ [McEPmUs][fUs][fA][mU][fU][mA][fA][mU][mA][fU][mC][mC][mC][fA][mC][fA][mG][mA][mA][mCs][mCs][mA] 3′),

wherein “m” is a 2′-O-methyl modified nucleotide, “f” is a 2′-F modified nucleotide, “s” is a phosphorothioate internucleotide linkage, “MeEP” is a mono methyl protected phosphate mimic.

30 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises any one of:

i) a sense strand of nucleic acid sequence according to SEQ ID NO: 441 (5′ [mCs][mAs][mA][mA][mG][fC][mU][fU][fU][fA][fU][mU][mU][mC][mA][mC][mA][mUs][m Us][mA][G1b][G1b][G1b] 3′);

ii) a sense strand of nucleic acid sequence according to SEQ ID NO: 443 (5′ [mUs][mAs][mU][mC][mA][fA][mA][fA][fC][fC][fU][mC][mA][mU][mG][mU][mC][mUs][m Cs][mA][G1b][G1b][G1b] 3′); or

iii) a sense strand of nucleic acid sequence according to SEQ ID NO: 445 (5′ [mGs][mUs][mU][mC][mU][fG][mU][fG][fG][fG][fA][mU][mA][mU][mU][mA][mA][mUs][m As][mA][G1b][G1b][G1b] 3′),

wherein “m” is a 2′-O-methyl modified nucleotide, “f” is a 2′-F modified nucleotide, “s” is a phosphorothioate internucleotide linkage, and “G1b” is a GalNac G1b moiety.

31 . A vector encoding the isolated oligonucleotide of claim 1 .

32 . (canceled)

33 . A pharmaceutical composition comprising the isolated oligonucleotide of claim 1 , and a pharmaceutically acceptable carrier, diluent or excipient.

34 . (canceled)

35 . A method of inhibiting or downregulating the expression or level of HSD17B13, or treating or preventing a disease or disorder associated with aberrant or increased expression or activity of HSD17B13 or a disease or disorder where HSD17B13 plays a role, in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of the isolated oligonucleotide of claim 1 .

36 . (canceled)