DOUBLE STRANDED RNA TARGETING ANGIOTENSINOGEN (AGT) AND METHODS OF USE THEREOF
The disclosure relates to isolated oligonucleotides comprising duplex regions targeting angiopoietin-like 3 (AGT), and delivery systems, kits and compositions comprising same, and methods of using same for inhibiting or downregulating AGT.
1 . An isolated oligonucleotide comprising a sense strand and an antisense strand, wherein:
the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising 19-25 nucleotides between any one of the nucleotide positions selected from:
a) 9 to 29;
b) 166 to 196;
c) 394 to 480;
d) 744 to 968;
e) 1110 to 1331;
f) 1410 to 1676; and
g) 1726 to 1894,
from the 5′ end of an angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1,
and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double stranded region.
2 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a nucleotide sequence that is identical to a region comprising 19-25 nucleotides between any one of the nucleotide positions selected from:
a) 9 to 29;
b) 166 to 196;
c) 394 to 480;
d) 744 to 968;
e) 1110 to 1331;
f) 1410 to 1676; and
g) 1726 to 1894,
from the 5′ end of an AGT mRNA sequence according to SEQ ID NO: 1.
3 . The isolated oligonucleotide of any one of claims 1 - 2 , wherein the sense strand comprises a nucleotide sequence that is substantially identical to a region between any one of the nucleotide positions from 1829 to 1857, from the 5′ end of an AGT mRNA sequence according to SEQ ID NO: 1.
4 . The isolated oligonucleotide of claim 3 , wherein the sense strand comprises a nucleotide sequence that is identical to a region between nucleotide positions 1829 to 1857, from the 5′ end of an AGT mRNA sequence according to SEQ ID NO: 1.
5 . The isolated oligonucleotide of any one of claims 1 - 2 , wherein the sense strand comprises a nucleotide sequence that is substantially identical to a region between any one of the nucleotide positions selected from:
a) 166 to 196;
b) 394 to 480;
c) 744 to 968;
d) 1110 to 1331;
e) 1410 to 1676; and
f) 1726 to 1894,
from the 5′ end of an AGT mRNA sequence according to SEQ ID NO: 1.
6 . The isolated oligonucleotide of claim 5 , wherein the sense strand comprises a nucleotide sequence that is identical to a region between any one of the nucleotide positions selected from:
a) 166 to 196;
b) 394 to 480;
c) 744 to 968;
d) 1110 to 1331;
e) 1410 to 1676; and
f) 1726 to 1894,
from the 5′ end of an AGT mRNA sequence according to SEQ ID NO: 1.
7 . The isolated oligonucleotide of any one of claims 1 - 2 , wherein the sense strand comprises a sequence that is substantially identical to a region comprising the sequence between any one of the nucleotide positions selected from:
a) 9 to 29;
b) 168 to 189;
c) 784 to 808;
d) 1264 to 1289;
e) 1607 to 1630; and
f) 1814 to 1882,
from the 5′ end of an AGT mRNA sequence according to SEQ ID NO: 1.
8 . The isolated oligonucleotide of claim 7 , wherein the sense strand comprises a sequence that is identical to a region comprising the sequence between any one of the nucleotide positions selected from:
a) 9 to 29;
b) 168 to 189;
c) 784 to 808;
d) 1264 to 1289;
e) 1607 to 1630; and
f) 1814 to 1882,
from the 5′ end of an AGT mRNA sequence according to SEQ ID NO: 1.
9 . The isolated oligonucleotide of any one of claims 1 - 8 , wherein the antisense strand comprises a 3′ overhang.
10 . The isolated oligonucleotide of any one of claims 1 - 9 , wherein the sense strand comprises an RNA sequence of at least 20 nucleotides in length.
11 . The isolated oligonucleotide of any one of claims 1 - 10 , wherein the antisense strand comprises an RNA sequence of at least 22 nucleotides in length.
12 . The isolated oligonucleotide of any one of claims 1 - 11 , wherein the double stranded region is between 19 and 21 nucleotides in length.
13 . The isolated oligonucleotide of claim 12 , wherein the double stranded region is 20 nucleotides in length.
14 . The isolated oligonucleotide of any one of claims 1 - 13 , wherein the antisense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 2-56.
15 . The isolated oligonucleotide of any one of claims 1 - 14 , wherein the sense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 57-111.
16 . The isolated oligonucleotide of claim 4 , wherein the double stranded region comprises:
i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 2 (5′ UGGAACACUUUUUUGUUUCACA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 57 (5′ UGAAACAAAAAAGUGUUCCA 3′); or
ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 3 (5′ UUUGAAAAGGGAACACUUUUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 58 (5′ AAAAGUGUUCCCUUUUCAAA 3′).
17 . The isolated oligonucleotide of claim 6 , wherein the double stranded region comprises:
i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 4 (5′ UCUCUCAUUGUGGAUGACGAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 59 (5′ UCGUCAUCCACAAUGAGAGA 3′);
ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 5 (5′ UCUCACAGGUACUCUCAUUGUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 60 (5′ CAAUGAGAGUACCUGUGAGA 3′);
iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 6 (5′ UCAUAGCUCACUGUGCAUGCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 61 (5′ GCAUGCACAGUGAGCUAUGA 3′);
iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 7 (5′ UUAGAGAGAGGCCAGGGUGCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 62 (5′ GCACCCUGGCCUCUCUCUAA 3′);
v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 8 (5′ UUGAAGUCCAGAGAGCGUGGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 63 (5′ CCACGCUCUCUGGACUUCAA 3′);
vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 9 (5′ UCUGUCAAUCUUCUCAGCAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 64 (5′ CUGCUGAGAAGAUUGACAGA 3′);
vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 10 (5′ UGUCCACCCAGAACUCCUGGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 65 (5′ CCAGGAGUUCUGGGUGGACA 3′);
viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 11 (5′ UCAGACACUGAGGUGCUGUUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 66 (5′ AACAGCACCUCAGUGUCUGA 3′);
ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 12 (5′ UUUUGCUGGAAAGUGAGACCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 67 (5′ GGUCUCACUUUCCAGCAAAA 3′);
x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 13 (5′ UGUUUCUUCAUCCAGUUGAGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 68 (5′ CUCAACUGGAUGAAGAAACA 3′);
xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 14 (5′ UAAAAUGCUGUUCAGCACCUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 69 (5′ AGGUGCUGAACAGCAUUUUA 3′);
xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 15 (5′ UAAAAAAAUGCUGUUCAGCACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 70 (5′ UGCUGAACAGCAUUUUUUUA 3′);
xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 16 (5′ UCAAAAAAAAUGCUGUUCAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 71 (5′ CUGAACAGCAUUUUUUUUGA 3′);
xiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 17 (5′ UCAGCAAACAGGAAUGGGCGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 72 (5′ CGCCCAUUCCUGUUUGCUGA 3′);
xv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 18 (5′ UGAAGAAAAGGUGGGAGACUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 73 (5′ AGUCUCCCACCUUUUCUUCA 3′);
xvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 19 (5′ UUUAGAAGAAAAGGUGGGAGAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 74 (5′ CUCCCACCUUUUCUUCUAAA 3′);
xviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 20 (5′ UAUUAGAAGAAAAGGUGGGAGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 75 (5′ UCCCACCUUUUCUUCUAAUA 3′);
xix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 21 (5′ UGAGAAACGGCUGCUUUCCAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 76 (5′ UGGAAAGCAGCCGUUUCUCA 3′);
xx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 22 (5′ UUUAGACCAAGGAGAAACGGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 77 (5′ CCGUUUCUCCUUGGUCUAAA 3′);
xxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 23 (5′ UCUUAGACCAAGGAGAAACGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 78 (5′ CGUUUCUCCUUGGUCUAAGA 3′);
xxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 24 (5′ UCACUUAGACCAAGGAGAAACG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 79 (5′ UUUCUCCUUGGUCUAAGUGA 3′);
xxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 25 (5′ UAAAAUAAACCCAGCAAACUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 80 (5′ AGUUUGCUGGGUUUAUUUUA 3′);
xxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 26 (5′ UUUCUCUAAAAUAAACCCAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 81 (5′ CUGGGUUUAUIUUUAGAGAAA 3′);
xxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 27 (5′ UUUUUUGGAACAGUAGUCCCGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 82 (5′ GGGACUACUGUUCCAAAAAA 3′);
xxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 28 (5′ UGUUUCACAAACAAGCUGGUCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 83 (5′ ACCAGCUUGUUUGUGAAACA 3′);
xxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 29 (5′ UUUUUUUGUUUCACAAACAAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 84 (5′ UUGUUUGUGAAACAAAAAAA 3′);
xxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 30 (5′ UCACUUUUUUGUUUCACAAACA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 85 (5′ UUUGUGAAACAAAAAAGUGA 3′);
xxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 31 (5′ UCUUGAAAAGGGAACACUUUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 86 (5′ AAAGUGUUCCCUUUUCAAGA 3′);
xxx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 32 (5′ UUGUUCUCAACUUGAAAAGGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 87 (5′ CCUUUUCAAGUUGAGAACAA 3′);
xxxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 33 (5′ UAUUUUUGUUCUCAACUUGAAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 88 (5′ UCAAGUUGAGAACAAAAAUA 3′);
xxxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 34 (5′ UAAUUUUUGUUCUCAACUUGAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 89 (5′ CAAGUUGAGAACAAAAAUUA 3′);
xxxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 35 (5′ UCAAUUUUUGUUCUCAACUUGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 90 (5′ AAGUUGAGAACAAAAAUUGA 3′); and
xxxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 36 (5′ UUUUUAAAACCCAAUUUUUGUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 91 (5′ CAAAAAUUGGGUUUUAAAAA 3′);
xxxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 37 (5′ UAUUUUAAAACCCAAUUUUUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 92 (5′ AAAAAUUGGGUUUUAAAAUA 3′);
xxxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 38 (5′ UAAUUUUAAAACCCAAUUUUUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 93 (5′ AAAAUUGGGUUUUAAAAUUA 3′)
xxxvii) an antisense of nucleic acid sequence according to SEQ ID NO: 39 (5′ UUUAAUUUUAAAACCCAAUUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 94 (5′ AAUUGGGUUUUAAAAUUAAA 3′)
xxxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 40 (5′ UAUACUUUAAUUUUAAAACCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 95 (5′ GGUUUUAAAAUUAAAGUAUA 3′);
xxxix) an antisense of nucleic acid sequence according to SEQ ID NO: 41 (5′ UUAUACUUUAAUUUUAAAACCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 96 (5′ GUUUUAAAAUUAAAGUAUAA 3′); or
xL) an antisense strand of nucleic acid sequence according to SEQ ID NO: 51 (5′ UCUCAUUAGAAGAAAAGGUGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 106 (5′ CACCUUUUCUUCUAAUGAGA 3′).
18 . The isolated oligonucleotide of claim 8 , wherein the double stranded region comprises:
i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 42 (5′ UGUAGUACCCAGAACAACGGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 97 (5′ CCGUUGUUCUGGGUACUACA 3′);
ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 43 (5′ UUACUCUCAUUGUGGAUGACGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 98 (5′ GUCAUCCACAAUGAGAGUAA 3′);
iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 44 (5′ UGUACUCUCAUUGUGGAUGACG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 99 (5′ UCAUCCACAAUGAGAGUACA 3′);
iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 45 (5′ UAUGAACCUGUCAAUCUUCUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 100 (5′ AGAAGAUUGACAGGUUCAUA 3′);
v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 46 (5′ UCUGCAUGAACCUGUCAAUCUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 101 (5′ GAUUGACAGGUUCAUGCAGA 3′);
vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 47 (5′ UCUCAAUUUUUGCAGGUUCAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 102 (5′ UGAACCUGCAAAAAUUGAGA 3′);
vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 48 (5′ UCAUUGCUCAAUUUUUGCAGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 103 (5′ CUGCAAAAAUUGAGCAAUGA 3′); or
viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 49 (5′ UUAGAAGAAAAGGUGGGAGACU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 104 (5′ UCUCCCACCUUUUCUUCUAA 3′);
ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 50 (5′ UCAUUAGAAGAAAAGGUGGGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 105 (5′ CCCACCUUUUCUUCUAAUGA 3′);
x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 52 (5′ UUUCACAAACAAGCUGGUCGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 107 (5′ CGACCAGCUUGUUUGUGAAA 3′);
xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 53 (5′ UUUUCACAAACAAGCUGGUCGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 108 (5′ GACCAGCUUGUUUGUGAAAA 3′);
xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 54 (5′ UCUCAACUUGAAAAGGGAACAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 109 (5′ GUUCCCUUUUCAAGUUGAGA 3′);
xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 55 (5′ UAAAACCCAAUUUUUGUUCUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 110 (5′ AGAACAAAAAUUGGGUUUUA 3′); or
xiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 56 (5′ UUUAAAACCCAAUUUUUGUUCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 111 (5′ AACAAAAAUUGGGUUUUAAA 3′).
19 . The isolated oligonucleotide of any one of claims 1 - 18 , wherein the isolated oligonucleotide attenuates expression of the AGT mRNA by 20% to 50% at a dose of 0.02 nM.
20 . The isolated oligonucleotide of claim 19 , wherein the double stranded region comprises:
i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 5 (5′ UCUCACAGGUACUCUCAUUGUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 60 (5′ CAAUGAGAGUACCUGUGAGA 3′) (42.5);
ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 6 (5′ UCAUAGCUCACUGUGCAUGCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 61 (5′ GCAUGCACAGUGAGCUAUGA 3′) (42.5);
iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 7 (5′ UUAGAGAGAGGCCAGGGUGCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 62 (5′ GCACCCUGGCCUCUCUCUAA 3′) (30.4);
iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 8 (5′ UUGAAGUCCAGAGAGCGUGGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 63 (5′ CCACGCUCUCUGGACUUCAA 3′) (37.9);
v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 9 (5′ UCUGUCAAUCUUCUCAGCAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 64 (5′ CUGCUGAGAAGAUUGACAGA 3′) (41.3);
vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 10 (5′ UGUCCACCCAGAACUCCUGGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 65 (5′ CCAGGAGUUCUGGGUGGACA 3′) (49.7);
vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 11 (5′ UCAGACACUGAGGUGCUGUUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 66 (5′ AACAGCACCUCAGUGUCUGA 3′) (35.4);
viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 12 (5′ UUUUGCUGGAAAGUGAGACCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 67 (5′ GGUCUCACUUUCCAGCAAAA 3′) (40.8);
ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 13 (5′ UGUUUCUUCAUCCAGUUGAGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 68 (5′ CUCAACUGGAUGAAGAAACA 3′) (39.7);
x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 17 (5′ UCAGCAAACAGGAAUGGGCGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 72 (5′ CGCCCAUUCCUGUUUGCUGA 3′) (39.3);
xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 18 (5′ UGAAGAAAAGGUGGGAGACUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 73 (5′ AGUCUCCCACCUUUUCUUCA 3′) (39);
xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 19 (5′ UUUAGAAGAAAAGGUGGGAGAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 74 (5′ CUCCCACCUUUUCUUCUAAA 3′) (48.5);
xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 21 (5′ UGAGAAACGGCUGCUUUCCAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 76 (5′ UGGAAAGCAGCCGUUUCUCA 3′) (49.5);
xiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 22 (5′ UUUAGACCAAGGAGAAACGGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 77 (5′ CCGUUUCUCCUUGGUCUAAA 3′) (43.6);
xv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 23 (5′ UCUUAGACCAAGGAGAAACGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 78 (5′ CGUUUCUCCUUGGUCUAAGA 3′) (42.1);
xvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 24 (5′ UCACUUAGACCAAGGAGAAACG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 79 (5′ UUUCUCCUUGGUCUAAGUGA 3′) (26.7);
xvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 25 (5′ UAAAAUAAACCCAGCAAACUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 80 (5′ AGUUUGCUGGGUUUAUUUUA 3′) (38.4);
xviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 26 (5′ UUUCUCUAAAAUAAACCCAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 81 (5′ CUGGGUUUAUUUUAGAGAAA 3′) (47.9);
xix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 32 (5′ UUGUUCUCAACUUGAAAAGGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 87 (5′ CCUUUUCAAGUUGAGAACAA 3′) (42.5);
xx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 33 (5′ UAUUUUUGUUCUCAACUUGAAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 88 (5′ UCAAGUUGAGAACAAAAAUA 3′) (34);
xxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 34 (5′ UAAUUUUUGUUCUCAACUUGAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 89 (5′ CAAGUUGAGAACAAAAAUUA 3′) (38.7);
xxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 36 (5′ UUUUUAAAACCCAAUUUUUGUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 91 (5′ CAAAAAUUGGGUUUUAAAAA 3′) (36.5);
xxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 38 (5′ UAAUUUUAAAACCCAAUUUUUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 93 (5′ AAAAUUGGGUUUUAAAAUUA 3′) (27.4);
xxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 39 (5′ UUUAAUUUUAAAACCCAAUUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 94 (5′ AAUUGGGUUUUAAAAUUAAA 3′) (36.1);
xxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 41 (5′ UUAUACUUUAAUUUUAAAACCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 96 (5′ GUUUUAAAAUUAAAGUAUAA 3′) (43.8);
xxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 42 (5′ UGUAGUACCCAGAACAACGGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 97 (5′ CCGUUGUUCUGGGUACUACA 3′) (45.6);
xxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 47 (5′ UCUCAAUUUUUGCAGGUUCAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 102 (5′ UGAACCUGCAAAAAUUGAGA 3′) (45.4);
xxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 48 (5′ UCAUUGCUCAAUUUUUGCAGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 103 (5′ CUGCAAAAAUUGAGCAAUGA 3′) (42.9);
xxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 51 (5′ UCUCAUUAGAAGAAAAGGUGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 106 (5′ CACCUUUUCUUCUAAUGAGA 3′) (39.06); or
xxx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 52 (5′ UUUCACAAACAAGCUGGUCGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 107 (5′ CGACCAGCUUGUUUGUGAAA 3′) (27.8);
xxxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 56 (5′ UUUAAAACCCAAUUUUUGUUCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 111 (5′ AACAAAAAUUGGGUUUUAAA 3′) (49.0);
xxxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 55 (5′ UAAAACCCAAUUUUUGUUCUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 110 (5′ AGAACAAAAAUUGGGUUUUA 3′) (44.8); or
xxxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 27 (5′ UUUUUUGGAACAGUAGUCCCGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 82 (5′ GGGACUACUGUUCCAAAAAA 3′) (35.8).
21 . The isolated oligonucleotide of any one of claims 1 - 20 , wherein the isolated oligonucleotide attenuates expression of the AGT mRNA by at least 50% at a dose of 0.02 nM.
22 . The isolated oligonucleotide of claim 21 , wherein the double stranded region comprises:
i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 2 (5′ UGGAACACUUUUUUGUUUCACA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 57 (5′ UGAAACAAAAAAGUGUUCCA 3′) (56.3);
ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 3 (5′ UUUGAAAAGGGAACACUUUUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 58 (5′ AAAAGUGUUCCCUUUUCAAA 3′) (54.5);
iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 4 (5′ UCUCUCAUUGUGGAUGACGAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 59 (5′ UCGUCAUCCACAAUGAGAGA 3′) (63.3);
iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 14 (5′ UAAAAUGCUGUUCAGCACCUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 69 (5′ AGGUGCUGAACAGCAUUUUA 3′) (55.8);
v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 15 (5′ UAAAAAAAUGCUGUUCAGCACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 70 (5′ UGCUGAACAGCAUUUUUUUA 3′) (52.6);
vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 16 (5′ UCAAAAAAAAUGCUGUUCAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 71 (5′ CUGAACAGCAUUUTUU GA 3′) (50.3);
vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 20 (5′ UAUUAGAAGAAAAGGUGGGAGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 75 (5′ UCCCACCUUUUCUUCUAAUA 3′) (76.8);
viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 29 (5′ UUUUUUUGUUUCACAAACAAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 84 (5′ UUGUUUGUGAAACAAAAAAA 3′) (52);
ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 30 (5′ UCACUUUUUUGUUUCACAAACA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 85 (5′ UUUGUGAAACAAAAAAGUGA 3′) (51.9);
x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 31 (5′ UCUUGAAAAGGGAACACUUUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 86 (5′ AAAGUGUUCCCUUUUCAAGA 3′) (65.7);
xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 35 (5′ UCAAUUUUUGUUCUCAACUUGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 90 (5′ AAGUUGAGAACAAAAAUUGA 3′) (54.9);
xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 37 (5′ UAUUUUAAAACCCAAUUUUUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 92 (5′ AAAAAUUGGGUUUUAAAAUA 3′) (57.9);
xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 40 (5′ UAUACUUUAAUUUUAAAACCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 95 (5′ GGUUUUAAAAUUAAAGUAUA 3′) (61.1);
xiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 43 (5′ UUACUCUCAUUGUGGAUGACGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 98 (5′ GUCAUCCACAAUGAGAGUAA 3′) (55.5);
xv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 44 (5′ UGUACUCUCAUUGUGGAUGACG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 99 (5′ UCAUCCACAAUGAGAGUACA 3′) (70.2);
xvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 45 (5′ UAUGAACCUGUCAAUCUUCUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 100 (5′ AGAAGAUUGACAGGUUCAUA 3′) (74.3);
xvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 46 (5′ UCUGCAUGAACCUGUCAAUCUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 101 (5′ GAUUGACAGGUUCAUGCAGA 3′) (62.6);
xviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 49 (5′ UUAGAAGAAAAGGUGGGAGACU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 104 (5′ UCUCCCACCUUUUCUUCUAA 3′) (63.5);
xix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 50 (5′ UCAUUAGAAGAAAAGGUGGGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 105 (5′ CCCACCUUUUCUUCUAAUGA 3′) (64.3); or
xx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 54 (5′ UCUCAACUUGAAAAGGGAACAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 109 (5′ GUUCCCUUUUCAAGUUGAGA 3′) (50.4).
23 . The isolated oligonucleotide of any one of claims 1 - 18 , wherein the isolated oligonucleotide attenuates expression of the AGT mRNA by at least 50% at a dose of 0.1 nM.
24 . The isolated oligonucleotide of claim 23 , wherein the double stranded region comprises:
i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 2 (5′ UGGAACACUUUUUUGUUUCACA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 57 (5′ UGAAACAAAAAAGUGUUCCA 3′) (75.5);
ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 3 (5′ UUUGAAAAGGGAACACUUUUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 58 (5′ AAAAGUGUUCCCUUUUCAAA 3′) (72.3);
iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 4 (5′ UCUCUCAUUGUGGAUGACGAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 59 (5′ UCGUCAUCCACAAUGAGAGA 3′) (78);
iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 5 (5′ UCUCACAGGUACUCUCAUUGUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 60 (5′ CAAUGAGAGUACCUGUGAGA 3′) (62.4);
v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 6 (5′ UCAUAGCUCACUGUGCAUGCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 61 (5′ GCAUGCACAGUGAGCUAUGA 3′) (66.2);
vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 7 (5′ UUAGAGAGAGGCCAGGGUGCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 62 (5′ GCACCCUGGCCUCUCUCUAA 3′) (64.9);
vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 8 (5′ UUGAAGUCCAGAGAGCGUGGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 63 (5′ CCACGCUCUCUGGACUUCAA 3′) (65.7);
viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 9 (5′ UCUGUCAAUCUUCUCAGCAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 64 (5′ CUGCUGAGAAGAUUGACAGA 3′) (65.2);
ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 10 (5′ UGUCCACCCAGAACUCCUGGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 65 (5′ CCAGGAGUUCUGGGUGGACA 3′) (61.7);
x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 11 (5′ UCAGACACUGAGGUGCUGUUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 66 (5′ AACAGCACCUCAGUGUCUGA 3′) (66);
xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 12 (5′ UUUUGCUGGAAAGUGAGACCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 67 (5′ GGUCUCACUUUCCAGCAAAA 3′) (65.4);
xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 13 (5′ UGUUUCUUCAUCCAGUUGAGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 68 (5′ CUCAACUGGAUGAAGAAACA 3′) (74.4);
xiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 14 (5′ UAAAAUGCUGUUCAGCACCUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 69 (5′ AGGUGCUGAACAGCAUUUUA 3′) (67);
xv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 15 (5′ UAAAAAAAUGCUGUUCAGCACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 70 (5′ UGCUGAACAGCAUUUUUUUA 3′) (68.3);
xvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 16 (5′ UCAAAAAAAAUGCUGUUCAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 71 (5′ CUGAACAGCAUUUTUU GA 3′) (73.6);
xviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 17 (5′ UCAGCAAACAGGAAUGGGCGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 72 (5′ CGCCCAUUCCUGUUUGCUGA 3′) (67.3);
xix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 18 (5′ UGAAGAAAAGGUGGGAGACUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 73 (5′ AGUCUCCCACCUUUUCUUCA 3′) (67.5);
xx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 19 (5′ UUUAGAAGAAAAGGUGGGAGAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 74 (5′ CUCCCACCUUUUCUUCUAAA 3′) (66.6);
xxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 20 (5′ UAUUAGAAGAAAAGGUGGGAGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 75 (5′ UCCCACCUUUUCUUCUAAUA 3′) (74.3);
xxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 21 (5′ UGAGAAACGGCUGCUUUCCAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 76 (5′ UGGAAAGCAGCCGUUUCUCA 3′) (77.8);
xxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 22 (5′ UUUAGACCAAGGAGAAACGGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 77 (5′ CCGUUUCUCCUUGGUCUAAA 3′) (74.1);
xxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 23 (5′ UCUUAGACCAAGGAGAAACGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 78 (5′ CGUUUCUCCUUGGUCUAAGA 3′) (76);
xxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 25 (5′ UAAAAUAAACCCAGCAAACUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 80 (5′ AGUUUGCUGGGUUUAUTUUUA 3′) (67.2);
xxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 27 (5′ UUUUUUGGAACAGUAGUCCCGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 82 (5′ GGGACUACUGUUCCAAAAAA 3′) (65.4)
xxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 24 (5′ UCACUUAGACCAAGGAGAAACG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 79 (5′ UUUCUCCUUGGUCUAAGUGA 3′) (61.5);
xxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 26 (5′ UUUCUCUAAAAUAAACCCAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 81 (5′ CUGGGUUUAUUUUAGAGAAA 3′) (61.8);
xxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 28 (5′ UGUUUCACAAACAAGCUGGUCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 83 (5′ ACCAGCUUGUUUGUGAAACA 3′) (62);
xxx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 29 (5′ UUUUUUUGUUUCACAAACAAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 84 (5′ UUGUUUGUGAAACAAAAAAA 3′) (77.3);
xxxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 30 (5′ UCACUUUUUUGUUUCACAAACA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 85 (5′ UUUGUGAAACAAAAAAGUGA 3′) (76.5);
xxxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 31 (5′ UCUUGAAAAGGGAACACUUUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 86 (5′ AAAGUGUUCCCUUUUCAAGA 3′) (73.8);
xxxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 32 (5′ UUGUUCUCAACUUGAAAAGGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 87 (5′ CCUUUUCAAGUUGAGAACAA 3′) (62.6);
xxxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 33 (5′ UAUUUUUGUUCUCAACUUGAAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 88 (5′ UCAAGUUGAGAACAAAAAUA 3′) (64.5);
xxxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 34 (5′ UAAUUUUUGUUCUCAACUUGAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 89 (5′ CAAGUUGAGAACAAAAAUUA 3′) (63.2);
xxxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 35 (5′ UCAAUUUUUGUUCUCAACUUGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 90 (5′ AAGUUGAGAACAAAAAUUGA 3′) (75.9);
xxxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 36 (5′ UUUUUAAAACCCAAUUUUUGUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 91 (5′ CAAAAAUUGGGUUUUAAAAA 3′) (68.3);
xxxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 37 (5′ UAUUUUAAAACCCAAUUUUUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 92 (5′ AAAAAUUGGGUUUUAAAAUA 3′) (65.7);
xxxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 38 (5′ UAAUUUUAAAACCCAAUUUUUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 93 (5′ AAAAUUGGGUUUUAAAAUUA 3′) (69.5);
xL) an antisense strand of nucleic acid sequence according to SEQ ID NO: 39 (5′ UUUAAUUUUAAAACCCAAUUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 94 (5′ AAUUGGGUUUUAAAAUUAAA 3′) (64.9);
xLi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 40 (5′ UAUACUUUAAUUUUAAAACCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 95 (5′ GGUUUUAAAAUUAAAGUAUA 3′) (69.6);
xLii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 41 (5′ UUAUACUUUAAUUUUAAAACCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 96 (5′ GUUUUAAAAUUAAAGUAUAA 3′) (77.6);
xLiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 42 (5′ UGUAGUACCCAGAACAACGGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 97 (5′ CCGUUGUUCUGGGUACUACA 3′) (63.2);
xLiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 43 (5′ UUACUCUCAUUGUGGAUGACGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 98 (5′ GUCAUCCACAAUGAGAGUAA 3′) (73.3);
XLV) an antisense strand of nucleic acid sequence according to SEQ ID NO: 44 (5′ UGUACUCUCAUUGUGGAUGACG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 99 (5′ UCAUCCACAAUGAGAGUACA 3′) (84.8);
XLVi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 45 (5′ UAUGAACCUGUCAAUCUUCUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 100 (5′ AGAAGAUUGACAGGUUCAUA 3′) (73);
XLVii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 46 (5′ UCUGCAUGAACCUGUCAAUCUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 101 (5′ GAUUGACAGGUUCAUGCAGA 3′) (63.6);
xLViii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 47 (5′ UCUCAAUUUUUGCAGGUUCAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 102 (5′ UGAACCUGCAAAAAUUGAGA 3′) (67.5);
xLix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 48 (5′ UCAUUGCUCAAUUUUUGCAGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 103 (5′ CUGCAAAAAUUGAGCAAUGA 3′) (62.6);
L) an antisense strand of nucleic acid sequence according to SEQ ID NO: 49 (5′ UUAGAAGAAAAGGUGGGAGACU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 104 (5′ UCUCCCACCUUUUCUUCUAA 3′) (78.5);
Li) an antisense strand of nucleic acid sequence according to SEQ ID NO: 50 (5′ UCAUUAGAAGAAAAGGUGGGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 105 (5′ CCCACCUUUUCUUCUAAUGA 3′) (70.2);
Lii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 51 (5′ UCUCAUUAGAAGAAAAGGUGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 106 (5′ CACCUUUUCUUCUAAUGAGA 3′) (78.2);
Liii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 52 (5′ UUUCACAAACAAGCUGGUCGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 107 (5′ CGACCAGCUUGUUUGUGAAA 3′) (63.2);
Liv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 53 (5′ UUUUCACAAACAAGCUGGUCGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 108 (5′ GACCAGCUUGUUUGUGAAAA 3′) (62);
Lv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 54 (5′ UCUCAACUUGAAAAGGGAACAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 109 (5′ GUUCCCUUUUCAAGUUGAGA 3′) (61);
Lvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 56 (5′ UUUAAAACCCAAUUUUUGUUCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 111 (5′ AACAAAAAUUGGGUUUUAAA 3′) (71.3); or
Lvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 55 (5′ UAAAACCCAAUUUUUGUUCUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 110 (5′ AGAACAAAAAUUGGGUUUUA 3′) (74.5).
25 . An isolated oligonucleotide comprising a sense strand and an antisense strand, wherein:
the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising 19-25 nucleotides between any one of the nucleotide positions selected from:
a) 11 to 42;
b) 144 to 284;
c) 303 to 405;
d) 441 to 580;
e) 690 to 802;
f) 863 to 883;
g) 922 to 966;
h) 1036 to 1056;
i) 1099 to 1153;
j) 1189 to 1282;
k) 1300 to 1367;
1) 1403 to 1517;
m) 1601 to 1651;
n) 1722 to 1890;
o) 1901 to 1948; and
p) 2017 to 2095,
from the 5′ end of an angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1,
and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double stranded region.
26 . The isolated oligonucleotide of claim 25 , wherein the isolated oligonucleotide attenuates expression of the AGT mRNA by at 20% to 50% at a dose of 0.1 nM.
27 . The isolated oligonucleotide of claim 26 , wherein the double stranded region comprises:
i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 237 (5′ UCUGUAGUACCCAGAACAACGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 404 (5′ GUUGUUCUGGGUACUACAGA 3′) (34.3);
ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 128 (5′ UCAUUGGCCUUUGCCAGCUGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 295 (5′ CAGCUGGCAAAGGCCAAUGA 3′) (39.5);
iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 145 (5′ UGUGCCAAAGACAGCCGUUGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 312 (5′ CAACGGCUGUCUUUGGCACA 3′) (39);
iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 240 (5′ UAUAGAGAGAGGCCAGGGUGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 407 (5′ CACCCUGGCCUCUCUCUAUA 3′) (35.9);
v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 241 (5′ UGAUUGCCUGUAGCCUGUCAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 408 (5′ UGACAGGCUACAGGCAAUCA 3′) (35.6);
vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 242 (5′ UCAGUUCUUGUCCUUCCAAGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 409 (5′ CUUGGAAGGACAAGAACUGA 3′) (42.8);
vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 243 (5′ UUAUAGAGAGCCAGGCCCUGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 410 (5′ CAGGGCCUGGCUCUCUAUAA 3′) (37.2);
viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 245 (5′ UGUAGGUGUUGAAAGCCAGGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 412 (5′ CCUGGCUUUCAACACCUACA 3′) (40.5);
ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 246 (5′ UCAGAACUCCUGGGGCUCGGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 413 (5′ CCGAGCCCCAGGAGUUCUGA 3′) (22.4);
x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 157 (5′ UUUGUCCACCCAGAACUCCUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 324 (5′ AGGAGUUCUGGGUGGACAAA 3′) (32.8);
xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 160 (5′ UGACACUGAGGUGCUGUUGUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 327 (5′ ACAACAGCACCUCAGUGUCA 3′) (34.1);
xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 247 (5′ UCUCUCAGUGAAGGGCACUUGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 414 (5′ AAGUGCCCUUCACUGAGAGA 3′) (27.2);
xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 165 (5′ UAAGUGAGACCCUCCACCUUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 332 (5′ AAGGUGGAGGGUCUCACUUA 3′) (40);
xiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 167 (5′ UGGAAAGUGAGACCCUCCACCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 334 (5′ GUGGAGGGUCUCACUUUCCA 3′) (41.8);
xv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 168 (5′ UCUGGAAAGUGAGACCCUCCAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 335 (5′ GGAGGGUCUCACUUUCCAGA 3′) (40.8);
xvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 171 (5′ UAGUUGAGGGAGUUUUGCUGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 338 (5′ CAGCAAAACUCCCUCAACUA 3′) (48.4);
xvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 177 (5′ UGAAUGGCGGGCAGCUCAGCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 344 (5′ GCUGAGCUGCCCGCCAUUCA 3′) (36.9);
xviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 182 (5′ UAAUUUUUGCAGGUUCAGCUCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 349 (5′ AGCUGAACCUGCAAAAAUUA 3′) (41.2);
xix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 251 (5′ UAUGCUGUUCAGCACCUCCCCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 418 (5′ GGGAGGUGCUGAACAGCAUA 3′) (43.5);
xx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 187 (5′ UUAGACUCUGUGGGCUCUCUCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 354 (5′ AGAGAGCCCACAGAGUCUAA 3′) (30.6);
xxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 254 (5′ UCAAACAGGAAUGGGCGGUUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 421 (5′ AACCGCCCAUUCCUGUUUGA 3′) (49.5);
xxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 190 (5′ UAUCAUACACAGCAAACAGGAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 357 (5′ CCUGUUUGCUGUGUAUGAUA 3′) (48.8);
xxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 201 (5′ UAAGAAAAGGUGGGAGACUGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 368 (5′ CAGUCUCCCACCUUUUCUUA 3′) (30.9);
xxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 259 (5′ UCUAAAAUAAACCCAGCAAACU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 426 (5′ UUUGCUGGGUUUAUUUUAGA 3′) (46.4);
xxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 273 (5′ UUUUUGGAACAGUAGUCCCGCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 440 (5′ CGGGACUACUGUUCCAAAAA 3′) (47.4);
xxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 207 (5′ UGUCGGUUGGAAUUCUUUUUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 374 (5′ AAAAAGAAUUCCAACCGACA 3′) (33.7);
xxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 208 (5′ UCAAACAAGCUGGUCGGUUGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 375 (5′ CAACCGACCAGCUUGUUUGA 3′) (47.5);
xxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 219 (5′ UCUUUAAUUUUAAAACCCAAUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 386 (5′ UUGGGUUUUAAAAUUAAAGA 3′) (46.8);
xxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 220 (5′ UAUACAAACCGAAGGCAAUGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 387 (5′ CAUUGCCUUCGGUUUGUAUA 3′) (39.6);
xxx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 221 (5′ UAAUACAAACCGAAGGCAAUGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 388 (5′ AUUGCCUUCGGUUUGUAUUA 3′) (33.2);
xxxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 224 (5′ UCACUAAAUACAAACCGAAGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 391 (5′ CUUCGGUUUGUAUUUAGUGA 3′) (30.2);
xxxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 225 (5′ UAAGACACUAAAUACAAACCGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 392 (5′ GGUUUGUAUUUAGUGUCUUA 3′) (32.9);
xxxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 226 (5′ UCAAGACACUAAAUACAAACCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 393 (5′ GUUUGUAUUUAGUGUCUUGA 3′) (32);
xxxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 120 (5′ UGGAAGGGGUGUAUGUACACCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 287 (5′ GUGUACAUACACCCCUUCCA 3′) (20.2);
xxxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 236 (5′ UAAGACGUUUAUUACUAACACA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 403 (5′ UGUUAGUAAUAAACGUCUUA 3′) (23.6); or
xxxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 122 (5′ UGGAUGACGAGGUGGAAGGGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 289 (5′ CCCUUCCACCUCGUCAUCCA 3′) (25.7);
xxxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 125 (5′ UCUCAUUGUGGAUGACGAGGUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 292 (5′ CCUCGUCAUCCACAAUGAGA 3′) (22.4);
xxxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 276 (5′ UACAAGCUGGUCGGUUGGAAUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 443 (5′ UUCCAACCGACCAGCUUGUA 3′) (36.3);
xxxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 127 (5′ UCUUUGCCAGCUGCUCACAGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 294 (5′ CUGUGAGCAGCUGGCAAAGA 3′) (35.8);
xL) an antisense strand of nucleic acid sequence according to SEQ ID NO: 239 (5′ UUUUCAUCCACAGGGGAUGUCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 406 (5′ ACAUCCCCUGUGGAUGAAAA 3′) (23.1);
xLi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 267 (5′ UGUUUUGCAGCGACUAGCACCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 434 (5′ GUGCUAGUCGCUGCAAAACA 3′) (43.1);
xLii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 129 (5′ UAAGUUGGCCAGCAUCCCGACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 296 (5′ UCGGGAUGCUGGCCAACUUA 3′) (25.2);
xLiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 133 (5′ UAUAUACGGAAGCCCAAGAAGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 300 (5′ UUCUUGGGCUUCCGUAUAUA 3′) (50.0);
xLiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 135 (5′ UAUAUAUACGGAAGCCCAAGAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 302 (5′ CUUGGGCUUCCGUAUAUAUA 3′) (33.6);
xLv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 136 (5′ UCAUAUAUACGGAAGCCCAAGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 303 (5′ UUGGGCUUCCGUAUAUAUGA 3′) (39.2);
xLvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 138 (5′ UCAUGCCAUAUAUACGGAAGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 305 (5′ CUUCCGUAUAUAUGGCAUGA 3′) (22.9);
xLvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 139 (5′ UCUGUGCAUGCCAUAUAUACGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 306 (5′ GUAUAUAUGGCAUGCACAGA 3′) (31.9);
xLviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 144 (5′ UCAAAGACAGCCGUUGGGGAGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 311 (5′ UCCCCAACGGCUGUCUUUGA 3′) (45.5);
xLix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 277 (5′ UTUCCAAGGAACACCCAGGAUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 444 (5′ UCCUGGGUGUUCCUUGGAAA 3′) (22.3);
L) an antisense strand of nucleic acid sequence according to SEQ ID NO: 149 (5′ UGACCUUGUGCGCAUCCAGCCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 316 (5′ GCUGGAUGCGCACAAGGUCA 3′) (41.9);
Li) an antisense strand of nucleic acid sequence according to SEQ ID NO: 151 (5′ UCAAACGGCUGCUUCAGGUGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 318 (5′ CACCUGAAGCAGCCGUUUGA 3′) (34.7);
Lii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 152 (5′ UCACAAACGGCUGCUUCAGGUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 319 (5′ CCUGAAGCAGCCGUUUGUGA 3′) (32.6);
Liii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 153 (5′ UUAGAGAGCCAGGCCCUGCACA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 320 (5′ UGCAGGGCCUGGCUCUCUAA 3′) (33.3);
Liv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 154 (5′ UAAGUCCAGAGAGCGUGGGAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 321 (5′ UCCCACGCUCUCUGGACUUA 3′) (29.8);
Lv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 155 (5′ UGUGAAGUCCAGAGAGCGUGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 322 (5′ CACGCUCUCUGGACUUCACA 3′) (28.3);
Lvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 244 (5′ UTUCUGUGAAGUCCAGAGAGCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 411 (5′ CUCUCUGGACUUCACAGAAA 3′) (23.1);
Lvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 278 (5′ UUCUCAGCAGCAACAUCCAGUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 445 (5′ CUGGAUGUUGCUGCUGAGAA 3′) (25.4);
Lviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 158 (5′ UCUGUUGUCCACCCAGAACUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 325 (5′ AGUUCUGGGUGGACAACAGA 3′) (32.2);
Lix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 164 (5′ UGUGAGACCCUCCACCUUGUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 331 (5′ ACAAGGUGGAGGGUCUCACA 3′) (35.0);
Lx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 166 (5′ UGAAAGUGAGACCCUCCACCUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 333 (5′ GGUGGAGGGUCUCACUUUCA 3′) (20.9);
Lxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 173 (5′ UAUCCAGUUGAGGGAGUUUUGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 340 (5′ AAAACUCCCUCAACUGGAUA 3′) (44.3);
Lxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 178 (5′ UCAGAAUGGCGGGCAGCUCAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 345 (5′ UGAGCUGCCCGCCAUUCUGA 3′) (24.0);
Lxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 250 (5′ UCUGUUCAGCACCUCCCCCACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 417 (5′ UGGGGGAGGUGCUGAACAGA 3′) (23.1);
Lxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 184 (5′ UAAAAAAUGCUGUUCAGCACCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 351 (5′ GUGCUGAACAGCAUUUUUUA 3′) (48.5);
Lxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 185 (5′ UAAAAAAAAUGCUGUUCAGCAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 352 (5′ GCUGAACAGCAUUUUUUUUA 3′) (41.6);
Lxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 270 (5′ UCUCUCUCAUCCGCUUCAAGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 437 (5′ CUUGAAGCGGAUGAGAGAGA 3′) (40.6);
Lxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 252 (5′ UCAGGAAUGGGCGGUUCAGGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 419 (5′ CCUGAACCGCCCAUUCCUGA 3′) (44.6);
Lxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 188 (5′ UCACAGCAAACAGGAAUGGGCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 355 (5′ CCCAUUCCUGUUUGCUGUGA 3′) (46.8);
Lxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 189 (5′ UAUACACAGCAAACAGGAAUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 356 (5′ AUUCCUGUUUGCUGUGUAUA 3′) (36.5);
Lxx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 192 (5′ UUUGAUCAUACACAGCAAACAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 359 (5′ GUUUGCUGUGUAUGAUCAAA 3′) (42.9);
Lxxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 193 (5′ UUUUGAUCAUACACAGCAAACA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 360 (5′ UUUGCUGUGUAUGAUCAAAA 3′) (29.7);
Lxxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 255 (5′ UGAAGUGCAGGGCAGUGGCGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 422 (5′ CGCCACUGCCCUGCACUUCA 3′) (36.7);
Lxxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 194 (5′ UCAGGAAGUGCAGGGCAGUGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 361 (5′ CACUGCCCUGCACUUCCUGA 3′) (22.8);
Lxxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 256 (5′ UCUCAUGCUGUGCUCAGCGGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 423 (5′ CCGCUGAGCACAGCAUGAGA 3′) (28.7);
Lxxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 195 (5′ UCUGGGGCCCUGGCCUCAUGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 362 (5′ CAUGAGGCCAGGGCCCCAGA 3′) (37.9);
Lxxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 198 (5′ UAAAAGGUGGGAGACUGGGGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 365 (5′ CCCCAGUCUCCCACCUUUUA 3′) (29.2);
Lxxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 199 (5′ UGAAAAGGUGGGAGACUGGGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 366 (5′ CCCAGUCUCCCACCUUUUCA 3′) (46.3);
Lxxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 271 (5′ UCUUUCCAGCUCAAAGUCGACU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 438 (5′ UCGACUUUGAGCUGGAAAGA 3′) (46.6);
Lxxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 257 (5′ UUAAACCCAGCAAACUGGGAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 424 (5′ UCCCAGUUUGCUGGGUUUAA 3′) (49.5);
Lxxx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 204 (5′ UCUGGUUCUUGCCUCCCCACCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 371 (5′ GUGGGGAGGCAAGAACCAGA 3′) (28.0);
Lxxxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 205 (5′ UAAACACUGGUUCUUGCCUCCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 372 (5′ GAGGCAAGAACCAGUGUUUA 3′) (48.5);
Lxxxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 260 (5′ UGUUGGAAUUCUUUUUGGAACA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 427 (5′ UUCCAAAAAGAAUUCCAACA 3′) (37.4);
Lxxxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 209 (5′ UUUGUUUCACAAACAAGCUGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 376 (5′ CAGCUUGUUUGUGAAACAAA 3′) (37.3);
Lxxxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 210 (5′ UUUUUGUUUCACAAACAAGCUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 377 (5′ GCUUGUUUGUGAAACAAAAA 3′) (20.4);
Lxxxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 227 (5′ UCUUACAUUCAAGACACUAAAU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 394 (5′ UUAGUGUCUUGAAUGUAAGA 3′) (44.3);
Lxxxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 229 (5′ UGUCAUGUUCUUACAUUCAAGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 396 (5′ UUGAAUGUAAGAACAUGACA 3′) (22.7);
Lxxxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 262 (5′ UGAAAUUCAGGUGCUUGCAUCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 429 (5′ AUGCAAGCACCUGAAUUUCA 3′) (24.9);
Lxxxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 263 (5′ UAACAGAAAUUCAGGUGCUUGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 430 (5′ AAGCACCUGAAUUUCUGUUA 3′) (24.8);
Lxxxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 265 (5′ UCAUUCAAACAGAAAUUCAGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 432 (5′ CUGAAUUUCUGUUUGAAUGA 3′) (34.5);
XC) an antisense strand of nucleic acid sequence according to SEQ ID NO: 266 (5′ UGAAAUAACCAGCUAUGGUUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 433 (5′ AACCAUAGCUGGUUAUUUCA 3′) (26.6);
XCi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 196 (5′ UGUGUUCUGGGGCCCUGGCCUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 363 (5′ GGCCAGGGCCCCAGAACACA 3′) (41); or
XCii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 112 (5′ UCUUCUGCUGUAGUACCCAGAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 279 (5′ CUGGGUACUACAGCAGAAGA 3′) (37.4).
28 . The isolated oligonucleotide of claim 25 , wherein the isolated oligonucleotide attenuates expression of the AGT mRNA by at least 50% at a dose of 0.1 nM.
29 . The isolated oligonucleotide of claim 28 , wherein the double stranded region comprises:
i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 113 (5′ UAUACCCUUCUGCUGUAGUACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 280 (5′ UACUACAGCAGAAGGGUAUA 3′) (54.0);
ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 126 (5′ UCACAGGUACUCUCAUUGUGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 293 (5′ CACAAUGAGAGUACCUGUGA 3′) (55.2);
iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 268 (5′ UCUCAACUUGUCUUCGGUGUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 435 (5′ ACACCGAAGACAAGUUGAGA 3′) (55.8);
iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 130 (5′ UAGAAGUUGGCCAGCAUCCCGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 297 (5′ GGGAUGCUGGCCAACUUCUA 3′) (50.8);
v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 132 (5′ UGGAAGCCCAAGAAGUUGGCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 299 (5′ GCCAACUUCUUGGGCUUCCA 3′) (57.6);
vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 133 (5′ UAUAUACGGAAGCCCAAGAAGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 300 (5′ UUCUUGGGCUUCCGUAUAUA 3′) (50.0);
vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 134 (5′ UUAUAUACGGAAGCCCAAGAAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 301 (5′ UCUUGGGCUUCCGUAUAUAA 3′) (58.8);
viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 137 (5′ UAUGCCAUAUAUACGGAAGCCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 304 (5′ GCUUCCGUAUAUAUGGCAUA 3′) (51.4);
ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 156 (5′ UGAACCUGUCAAUCUUCUCAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 323 (5′ UGAGAAGAUUGACAGGUUCA 3′) (54.2);
x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 169 (5′ UGUUUUGCUGGAAAGUGAGACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 336 (5′ UCUCACUUUCCAGCAAAACA 3′) (54.6);
xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 170 (5′ UGAGUUUUGCUGGAAAGUGAGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 337 (5′ UCACUUUCCAGCAAAACUCA 3′) (52.3);
xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 176 (5′ UUUUCUUCAUCCAGUUGAGGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 343 (5′ CCUCAACUGGAUGAAGAAAA 3′) (56.4);
xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 248 (5′ UUAAGAUCCUUGCAGCACCAGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 415 (5′ UGGUGCUGCAAGGAUCUUAA 3′) (55.8);
xiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 179 (5′ UUUUUGCAGGUUCAGCUCGGUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 346 (5′ CCGAGCUGAACCUGCAAAAA 3′) (53.4);
xv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 180 (5′ UUUUUUGCAGGUUCAGCUCGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 347 (5′ CGAGCUGAACCUGCAAAAAA 3′) (54.9);
xvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 181 (5′ UAUUUUUGCAGGUUCAGCUCGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 348 (5′ GAGCUGAACCUGCAAAAAUA 3′) (55.8);
xvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 183 (5′ UCAAUUUUUGCAGGUUCAGCUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 350 (5′ GCUGAACCUGCAAAAAUUGA 3′) (53.8);
xviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 269 (5′ UCUCUCAUCCGCUUCAAGCUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 436 (5′ AGCUUGAAGCGGAUGAGAGA 3′) (51.4);
xix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 186 (5′ UGACUCUGUGGGCUCUCUCUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 353 (5′ AGAGAGAGCCCACAGAGUCA 3′) (54.6);
xx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 253 (5′ UAACAGGAAUGGGCGGUUCAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 420 (5′ UGAACCGCCCAUUCCUGUUA 3′) (52.4);
xxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 191 (5′ UGAUCAUACACAGCAAACAGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 358 (5′ CUGUUUGCUGUGUAUGAUCA 3′) (59.3);
xxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 200 (5′ UAGAAAAGGUGGGAGACUGGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 367 (5′ CCAGUCUCCCACCUUUUCUA 3′) (56.1);
xxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 217 (5′ UUUUAAAACCCAAUUUUUGUUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 384 (5′ ACAAAAAUUGGGUUUUAAAA 3′) (59.0);
xxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 258 (5′ UAAUAAACCCAGCAAACUGGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 425 (5′ CCAGUUUGCUGGGUUUAUUA 3′) (55.4);
xxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 202 (5′ UAUUCUCUAAAAUAAACCCAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 369 (5′ UGGGUUUAUUUUAGAGAAUA 3′) (50.5);
xxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 206 (5′ UUAAACACUGGUUCUUGCCUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 373 (5′ AGGCAAGAACCAGUGUUUAA 3′) (58.6);
xxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 272 (5′ UUUUGGAACAGUAGUCCCGCGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 439 (5′ GCGGGACUACUGUUCCAAAA 3′) (54.8);
xxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 274 (5′ UCUUUUUGGAACAGUAGUCCCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 441 (5′ GGACUACUGUUCCAAAAAGA 3′) (57.5);
xxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 275 (5′ UUUCUUUUUGGAACAGUAGUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 442 (5′ ACUACUGUUCCAAAAAGAAA 3′) (50.7);
xxx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 211 (5′ UUUUUUGUUUCACAAACAAGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 378 (5′ CUUGUUUGUGAAACAAAAAA 3′) (59.9);
xxxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 212 (5′ UAAAAGGGAACACUUUUUUGUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 379 (5′ CAAAAAAGUGUUCCCUUUUA 3′) (55.7);
xxxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 214 (5′ UCAACUUGAAAAGGGAACACUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 381 (5′ GUGUUCCCUUUUCAAGUUGA 3′) (54.9);
xxxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 218 (5′ UUUUAAUUUUAAAACCCAAUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 385 (5′ AUUGGGUUUUAAAAUUAAAA 3′) (56.5).
30 . The isolated oligonucleotide of any one of claims 25 - 29 , wherein the isolated oligonucleotide attenuates expression of the AGT mRNA by 20% to 50% at a dose of 0.02 nM.
31 . The isolated oligonucleotide of claim 30 , wherein the double stranded region comprises:
i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 237 (5′ UCUGUAGUACCCAGAACAACGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 404 (5′ GUUGUUCUGGGUACUACAGA 3′) (29.7);
ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 113 (5′ UAUACCCUUCUGCUGUAGUACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 280 (5′ UACUACAGCAGAAGGGUAUA 3′) (32.8);
iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 126 (5′ UCACAGGUACUCUCAUUGUGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 293 (5′ CACAAUGAGAGUACCUGUGA 3′) (35.0);
iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 128 (5′ UCAUUGGCCUUUGCCAGCUGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 295 (5′ CAGCUGGCAAAGGCCAAUGA 3′) (23.9);
v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 268 (5′ UCUCAACUUGUCUUCGGUGUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 435 (5′ ACACCGAAGACAAGUUGAGA 3′) (26.5);
vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 130 (5′ UAGAAGUUGGCCAGCAUCCCGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 297 (5′ GGGAUGCUGGCCAACUUCUA 3′) (24.4);
vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 131 (5′ UCAAGAAGUUGGCCAGCAUCCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 298 (5′ GAUGCUGGCCAACUUCUUGA 3′) (22.0);
viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 132 (5′ UGGAAGCCCAAGAAGUUGGCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 299 (5′ GCCAACUUCUUGGGCUUCCA 3′) (34.0);
ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 133 (5′ UAUAUACGGAAGCCCAAGAAGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 300 (5′ UUCUUGGGCUUCCGUAUAUA 3′) (21.8);
x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 134 (5′ UUAUAUACGGAAGCCCAAGAAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 301 (5′ UCUUGGGCUUCCGUAUAUAA 3′) (35.0);
xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 137 (5′ UAUGCCAUAUAUACGGAAGCCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 304 (5′ GCUUCCGUAUAUAUGGCAUA 3′) (25.8);
xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 145 (5′ UGUGCCAAAGACAGCCGUUGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 312 (5′ CAACGGCUGUCUUUGGCACA 3′) (25.2);
xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 240 (5′ UAUAGAGAGAGGCCAGGGUGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 407 (5′ CACCCUGGCCUCUCUCUAUA 3′) (33.1);
xiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 241 (5′ UGAUUGCCUGUAGCCUGUCAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 408 (5′ UGACAGGCUACAGGCAAUCA 3′) (25.3);
xv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 242 (5′ UCAGUUCUUGUCCUUCCAAGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 409 (5′ CUUGGAAGGACAAGAACUGA 3′) (28.4);
xvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 243 (5′ UUAUAGAGAGCCAGGCCCUGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 410 (5′ CAGGGCCUGGCUCUCUAUAA 3′) (31.9);
xvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 156 (5′ UGAACCUGUCAAUCUUCUCAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 323 (5′ UGAGAAGAUUGACAGGUUCA 3′) (31.2);
xviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 245 (5′ UGUAGGUGUUGAAAGCCAGGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 412 (5′ CCUGGCUUUCAACACCUACA 3′) (26.8);
xix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 246 (5′ UCAGAACUCCUGGGGCUCGGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 413 (5′ CCGAGCCCCAGGAGUUCUGA 3′) (20.8);
xx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 160 (5′ UGACACUGAGGUGCUGUUGUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 327 (5′ ACAACAGCACCUCAGUGUCA 3′) (21.2);
xxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 247 (5′ UCUCUCAGUGAAGGGCACUUGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 414 (5′ AAGUGCCCUUCACUGAGAGA 3′) (20.5);
xxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 165 (5′ UAAGUGAGACCCUCCACCUUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 332 (5′ AAGGUGGAGGGUCUCACUUA 3′) (20.3);
xxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 167 (5′ UGGAAAGUGAGACCCUCCACCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 334 (5′ GUGGAGGGUCUCACUUUCCA 3′) (27.1);
xxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 168 (5′ UCUGGAAAGUGAGACCCUCCAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 335 (5′ GGAGGGUCUCACUUUCCAGA 3′) (21.0);
xxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 169 (5′ UGUUUUGCUGGAAAGUGAGACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 336 (5′ UCUCACUUUCCAGCAAAACA 3′) (25.6);
xxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 170 (5′ UGAGUUUUGCUGGAAAGUGAGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 337 (5′ UCACUUUCCAGCAAAACUCA 3′) (28.2);
xxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 171 (5′ UAGUUGAGGGAGUUUUGCUGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 338 (5′ CAGCAAAACUCCCUCAACUA 3′) (31.1);
xxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 172 (5′ UCAGUUGAGGGAGUUUUGCUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 339 (5′ AGCAAAACUCCCUCAACUGA 3′) (24.8);
xxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 176 (5′ UUUUCUUCAUCCAGUUGAGGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 343 (5′ CCUCAACUGGAUGAAGAAAA 3′) (21.6);
xxx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 248 (5′ UUAAGAUCCUUGCAGCACCAGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 415 (5′ UGGUGCUGCAAGGAUCUUAA 3′) (32.6);
xxxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 177 (5′ UGAAUGGCGGGCAGCUCAGCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 344 (5′ GCUGAGCUGCCCGCCAUUCA 3′) (37.6);
xxxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 179 (5′ UUUUUGCAGGUUCAGCUCGGUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 346 (5′ CCGAGCUGAACCUGCAAAAA 3′) (26.9);
xxxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 180 (5′ UUUUUUGCAGGUUCAGCUCGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 347 (5′ CGAGCUGAACCUGCAAAAAA 3′) (29.2);
xxxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 270 (5′ UCUCUCUCAUCCGCUUCAAGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 437 (5′ CUUGAAGCGGAUGAGAGAGA 3′) (22.7);
xxxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 187 (5′ UUAGACUCUGUGGGCUCUCUCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 354 (5′ AGAGAGCCCACAGAGUCUAA 3′) (25.9);
xxxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 254 (5′ UCAAACAGGAAUGGGCGGUUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 421 (5′ AACCGCCCAUUCCUGUUUGA 3′) (22.4);
xxxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 190 (5′ UAUCAUACACAGCAAACAGGAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 357 (5′ CCUGUUUGCUGUGUAUGAUA 3′) (22.9);
xxxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 191 (5′ UGAUCAUACACAGCAAACAGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 358 (5′ CUGUUUGCUGUGUAUGAUCA 3′) (31.5);
xxxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 195 (5′ UCUGGGGCCCUGGCCUCAUGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 362 (5′ CAUGAGGCCAGGGCCCCAGA 3′) (32.1);
xL) an antisense strand of nucleic acid sequence according to SEQ ID NO: 196 (5′ UGUGUUCUGGGGCCCUGGCCUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 363 (5′ GGCCAGGGCCCCAGAACACA 3′) (35.3);
xLi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 200 (5′ UAGAAAAGGUGGGAGACUGGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 367 (5′ CCAGUCUCCCACCUUUUCUA 3′) (25.7);
xLii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 201 (5′ UAAGAAAAGGUGGGAGACUGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 368 (5′ CAGUCUCCCACCUUUUCUUA 3′) (21.7);
xLiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 259 (5′ UCUAAAAUAAACCCAGCAAACU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 426 (5′ UUUGCUGGGUUUAUUUUAGA 3′) (20.0);
xLiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 202 (5′ UAUUCUCUAAAAUAAACCCAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 369 (5′ UGGGUUUAUUUUAGAGAAUA 3′) (24.7);
xLv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 272 (5′ UUUUGGAACAGUAGUCCCGCGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 439 (5′ GCGGGACUACUGUUCCAAAA 3′) (23.2);
xLvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 273 (5′ UUUUUGGAACAGUAGUCCCGCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 440 (5′ CGGGACUACUGUUCCAAAAA 3′) (34.6);
xLvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 274 (5′ UCUUUUUGGAACAGUAGUCCCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 441 (5′ GGACUACUGUUCCAAAAAGA 3′) (27.2);
xLviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 275 (5′ UUUCUUUUUGGAACAGUAGUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 442 (5′ ACUACUGUUCCAAAAAGAAA 3′) (22.6);
xLix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 207 (5′ UGUCGGUUGGAAUUCUUUUUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 374 (5′ AAAAAGAAUUCCAACCGACA 3′) (24.1);
L) an antisense strand of nucleic acid sequence according to SEQ ID NO: 208 (5′ UCAAACAAGCUGGUCGGUUGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 375 (5′ CAACCGACCAGCUUGUUUGA 3′) (26.8);
Li) an antisense strand of nucleic acid sequence according to SEQ ID NO: 211 (5′ UUUUUUGUUUCACAAACAAGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 378 (5′ CUUGUUUGUGAAACAAAAAA 3′) (28.9);
Lii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 212 (5′ UAAAAGGGAACACUUUUUUGUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 379 (5′ CAAAAAAGUGUUCCCUUUUA 3′) (35.6);
Liii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 217 (5′ UUUUAAAACCCAAUUUUUGUUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 384 (5′ ACAAAAAUUGGGUUUUAAAA 3′) (32.3);
Liv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 219 (5′ UCUUUAAUUUUAAAACCCAAUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 386 (5′ UUGGGUUUUAAAAUUAAAGA 3′) (31.1);
Lv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 220 (5′ UAUACAAACCGAAGGCAAUGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 387 (5′ CAUUGCCUUCGGUUUGUAUA 3′) (37.1);
Lvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 221 (5′ UAAUACAAACCGAAGGCAAUGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 388 (5′ AUUGCCUUCGGUUUGUAUUA 3′) (30.5);
Lvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 223 (5′ UCUAAAUACAAACCGAAGGCAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 390 (5′ GCCUUCGGUUUGUAUUUAGA 3′) (26.6);
Lviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 224 (5′ UCACUAAAUACAAACCGAAGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 391 (5′ CUUCGGUUUGUAUUUAGUGA 3′) (28.4);
Lix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 225 (5′ UAAGACACUAAAUACAAACCGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 392 (5′ GGUUUGUAUUUAGUGUCUUA 3′) (44.1);
Lx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 226 (5′ UCAAGACACUAAAUACAAACCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 393 (5′ GUUUGUAUUUAGUGUCUUGA 3′) (26.0);
Lxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 235 (5′ UGAGAAAUAACCAGCUAUGGUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 402 (5′ CCAUAGCUGGUUAUUUCUCA 3′) (20.5);
Lxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 236 (5′ UAAGACGUUUAUUACUAACACA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 403 (5′ UGUUAGUAAUAAACGUCUUA 3′) (34.5);
Lxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 251 (5′ UAUGCUGUUCAGCACCUCCCCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 418 (5′ GGGAGGUGCUGAACAGCAUA 3′) (20.8);
Liv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 269 (5′ UCUCUCAUCCGCUUCAAGCUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 436 (5′ AGCUUGAAGCGGAUGAGAGA 3′) (29.4); or
Lv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 186 (5′ UGACUCUGUGGGCUCUCUCUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 353 (5′ AGAGAGAGCCCACAGAGUCA 3′) (35.1).
32 . The isolated oligonucleotide of any one of claims 25 - 29 , wherein the isolated oligonucleotide attenuates expression of the AGT mRNA by at least 50% at a dose of 0.02 nM.
33 . The isolated oligonucleotide of claim 32 , wherein the double stranded region comprises:
i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 157 (5′ UUUGUCCACCCAGAACUCCUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 324 (5′ AGGAGUUCUGGGUGGACAAA 3′) (53.4);
ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 206 (5′ UUAAACACUGGUUCUUGCCUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 373 (5′ AGGCAAGAACCAGUGUUUAA 3′) (59.1);
iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 214 (5′ UCAACUUGAAAAGGGAACACUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 381 (5′ GUGUUCCCUUUUCAAGUUGA 3′) (56.3); or
iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 218 (5′ UUUUAAUUUUAAAACCCAAUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 385 (5′ AUUGGGUUUUAAAAUUAAAA 3′) (52.9).
34 . The isolated oligonucleotide of any one of claims 1 - 33 , wherein the sense strand or the antisense strand or both comprise one or more modified nucleotide(s).
35 . The isolated oligonucleotide of claim 34 , wherein the antisense strand comprises a mono methyl protected phosphate mimic (5′-MeEP).
36 . The isolated oligonucleotide of any one of claims 1 - 35 , wherein in the sense strand or the antisense strand or both, a terminal or internal nucleotide is linked to a targeting ligand.
37 . The isolated oligonucleotide of claim 36 , wherein the targeting ligand comprises at least one GalNAc G1b moiety.
38 . The isolated oligonucleotide of any one of claims 1 - 37 , wherein the antisense strand comprises nucleotides modified with 2′-F modification, and nucleotides modified with 2′-O-methyl modification, according to the formula:
3′(M) 0 (F) 0 (M) 6 (F) 1 (M) 1 (F) 1 (M) 3 (F) 1 (M) 2 (F) 1 (M) 1 (F) 1 (M) 1 (F) 2 (M) 1 5′.
39 . The isolated oligonucleotide of any one of claims 1 - 38 , wherein the sense strand comprises nucleotides modified with 2′-F modification, and nucleotides modified with 2′-O-methyl modification, according to the formula:
5′(M) 0 (F) 0 (M) 5 (F) 1 (M) 1 (F) 4 (M) 9 3′.
40 . The isolated oligonucleotide of any one of claims 1 - 39 , wherein the antisense strand comprises any one of:
i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 447 (5′ [MeEPmUs][fCs][fA][mA][fA][mA][fA][mA][mA][fA][mU][mG][mC][fJ][mG][fJ][mU][mC][mA][mGs][mCs][mA] 3′);
ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 448 (5′ [MeEPmUs][fCs][fA][mC][fJ][mU][fU][mU][mU][fU][mG][mU][mU][fJ][mC][fA][mC][mA][mA][mAs][mCs][mA] 3′);
iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 449 (5′ [MeEPmUs][fGs][fG][mA][fA][mC][fA][mC][mU][fU][mU][mU][mU][fJ][mG][fU][mU][mU][mC][mAs][mCs][mA] 3′);
iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 450 (5′ [MeEPmUs][fUs][fU][mG][fA][mA][fA][mA][mG][fG][mG][mA][mA][fC][mA][fC][mU][mU][mU][mUs][mUs][mU] 3′);
v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 451 (5′ [MeEPmUs][fCs][fA][mA][fJ][mU][fU][mU][mU][fG][mU][mU][mC][fJ][mC][fA][mA][mC][mU][mUs][mGs][mA] 3′);
vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 452 (5′ [MeEPmUs][fAs][fA][mA][fA][mC][fC][mC][mA][fA][mU][mU][mU][fJ][mU][fG][mU][mU][mC][mUs][mCs][mA] 3′);
vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 453 (5′ [MeEPmUs][fAs][fU][mU][fU][mU][fA][mA][mA][fA][mC][mC][mC][fA][mA][fU][mU][mU][mU][mUs][mGs][mU] 3′);
viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 454 (5′ [MeEPmUs][fAs][fU][mA][fC][mU][fU][mU][mA][fA][mU][mU][mU][fU][mA][fA][mA][mA][mC][mCs][mCs][mA] 3′);
ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 455 (5′ [MeEPmUs][fUs][fA][mU][fA][mC][fU][mU][mU][fA][mA][mU][mU][fU][mU][fA][mA][mA][mA][mCs][mCs][mC] 3′);
x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 456 (5′ [mUs][fGs][fU][mA][fC][mU][fC][mU][mC][fA][mU][mU][mG][fU][mG][fG][mA][mU][mG][mAs][mCs][mG] 3′);
xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 457 (5′ [EPmUs][fGs][fU][mA][fC][mU][fC][mU][mC][fA][mU][mU][mG][fU][mG][fG][mA][mU][m G][mAs][mCs][mG] 3′); or
xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 458 (5′ [MeEPmUs][fGs][fU][mA][fC][mU][fC][mU][mC][fA][mU][mU][mG][fJ][mG][fG][mA][mU][mG][mAs][mCs][mG] 3′),
wherein “m” is a 2′-O-methyl modified nucleotide, “f” is a 2′-F modified nucleotide, “s” is a phosphorothioate internucleotide linkage, “MeEP” is a mono methyl protected phosphate mimic.
41 . The isolated oligonucleotide of any one of claims 1 - 40 , wherein the sense strand comprises any one of:
i) a sense strand of nucleic acid sequence according to SEQ ID NO: 460 (5′ [mCs][mUs][mG][mA][mA][fC][mA][fG][fC][fA][fJ][mU][mU][mU][mU][mU][mU][mUs][m Gs][mA][G1b][G1b][G1b] 3′);
ii) a sense strand of nucleic acid sequence according to SEQ ID NO: 461 (5′ [mUs][mUs][mU][mG][mU][fG][mA][fA][fA][fC][fA][mA][mA][mA][mA][mA][mG][mUs][m Gs][mA][G1b][G1b][G1b] 3′);
iii) a sense strand of nucleic acid sequence according to SEQ ID NO: 462 (5′ [mUs][mGs][mA][mA][mA][fC][mA][fA][fA][fA][fA][mA][mG][mU][mG][mU][mU][mCs][m Cs][mA][G1b][G1b][G1b] 3′);
iv) a sense strand of nucleic acid sequence according to SEQ ID NO: 463 (5′ [mAs][mAs][mA][mA][mG][fU][mG][fU][fU][fC][fC][mC][mU][mU][mU][mU][mC][mAs][m As][mA][G1b][G1b][G1b] 3′);
v) a sense strand of nucleic acid sequence according to SEQ ID NO: 464 (5′ [mAs][mAs][mG][mU][mU][fG][mA][fG][fA][fA][fC][mA][mA][mA][mA][mA][mU][mUs][m Gs][mA][G1b][G1b][G1b] 3′);
vi) a sense strand of nucleic acid sequence according to SEQ ID NO: 465 (5′ [mAs][mGs][mA][mA][mC][fA][mA][fA][fA][fA][fU][mU][mG][mG][mG][mU][mU][mUs][m Us][mA][G1b][G1b][G1b] 3′);
vii) a sense strand of nucleic acid sequence according to SEQ ID NO: 466 (5′ [mAs][mAs][mA][mA][mA][fU][mU][fG][fG][fG][fU][mU][mU][mU][mA][mA][mA][mAs][mUs][mA][G1b][G1b][G1b] 3′);
viii) a sense strand of nucleic acid sequence according to SEQ ID NO: 467 (5′ [mGs][mGs][mU][mU][mU][fU][mA][fA][fA][fA][fU][mU][mA][mA][mA][mG][mU][mAs][mUs][mA][G1b][G1b][G1b] 3′);
ix) a sense strand of nucleic acid sequence according to SEQ ID NO: 468 (5′ [mGs][mUs][mU][mU][mU][fA][mA][fA][fA][fJ][fU][mA][mA][mA][mG][mU][mA][mUs][mAs][mA][G1b][G1b][G1b] 3′); or
x) a sense strand of nucleic acid sequence according to SEQ ID NO: 469 (5′ [mUs][mCs][mA][mU][mC][fC][mA][fC][fA][fA][fU][mG][mA][mG][mA][mG][mU][mAs][m Cs][mA][G1b][G1b][G1b] 3′),
wherein “m” is a 2′-O-methyl modified nucleotide, “f” is a 2′-F modified nucleotide, “s” is a phosphorothioate internucleotide linkage, and “G1b” is a GalNac G1b moiety.
42 . A vector encoding the isolated oligonucleotide of any one of claims 1 - 41 .
43 . A delivery system comprising the isolated oligonucleotide of any one of claims 1 - 41 or the vector of claim 42 .
44 . A pharmaceutical composition comprising the isolated oligonucleotide of any one of claims 1 - 41 , the vector of claim 42 , and a pharmaceutically acceptable carrier, diluent or excipient.
45 . A kit comprising the isolated oligonucleotide of any one of claims 1 - 41 , the vector of claim 42 , or the pharmaceutical composition of claim 44 .
46 . A method of inhibiting or downregulating the expression or level of AGT in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of the isolated oligonucleotide of any one of claims 1 - 41 , the vector of claim 42 , or the pharmaceutical composition of claim 44 .
47 . A method of inhibiting or downregulating the expression or level of AGT in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of a first and at least a second isolated oligonucleotide of any one of claims 1 - 41 , wherein the first and at least the second oligonucleotide comprises different sequences.
48 . A method of treating or preventing a disease or disorder associated with aberrant or increased expression or activity of AGT or a disease or disorder where AGT plays a role in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of the isolated oligonucleotide of any one of claims 1 - 41 , the vector of claim 42 , or the pharmaceutical composition of claim 44 .