IP Library › Patent Application 18487663
Patent Application
App. No. 18/487,663

SMALL INTERFERING RNA TARGETING C3 AND USES THEREOF

Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US None
App. No.
18/487,663
Abstract

This disclosure relates to isolated oligonucleotides comprising duplex regions targeting human complement C3 mRNA, and delivery systems, kits and compositions comprising the same, and methods of using the same for inhibiting or downregulating C3 gene expression.

Claims (416)

1 . An isolated oligonucleotide comprising a sense strand and an antisense strand, wherein:

the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising 19-25 nucleotides between any one of the nucleotide positions selected from:

a) 588 to 608;

b) 772 to 801;

c) 1281 to 1301;

d) 1797 to 1817;

e) 2424 to 2444;

f) 2533 to 2585;

g) 2862 to 2882;

h) 3778 to 3836;

i) 4123 to 4169; and

j) 4402 to 4625,

from the 5′ end of a human complement C3 mRNA sequence according to SEQ ID NO: 1,

and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double stranded region.

2 .- 3 . (canceled)

4 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a nucleotide sequence that is substantially identical to a region between any one of the nucleotide positions selected from:

a) 1281 to 1301;

b) 1797 to 1817;

c) 2862 to 2882;

d) 4402 to 4424; and

e) 4520 to 4540,

from the 5′ end of a human complement C3 mRNA sequence according to SEQ ID NO: 1.

5 .- 6 . (canceled)

7 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising the sequence between any one of the nucleotide positions selected from:

a) 772 to 801;

b) 2424 to 2444;

c) 3784 to 3805;

d) 4123 to 4169;

e) 4438 to 4509; and

f) 4558 to 4621,

from the 5′ end of a human complement C3 mRNA sequence according to SEQ ID NO: 1.

8 .- 9 . (canceled)

10 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a sequence that is substantially identical to a region comprising the sequence between any one of the nucleotide positions selected from:

a) 588 to 608;

b) 773 to 800;

c) 2533 to 2585;

d) 3778 to 3836;

e) 4492 to 4512; and

f) 4600 to 4625,

from the 5′ end of a human complement C3 mRNA sequence according to SEQ ID NO: 1.

11 .- 26 . (canceled)

27 . The isolated oligonucleotide of claim 1 , wherein the antisense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 2-31.

28 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs:

32-61.

29 . The isolated oligonucleotide of claim 4 , wherein the double stranded region comprises:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 10 (5′ UGUGUGUUGAUGCUGAGUUUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 40 (5′ AAACUCAGCAUCAACACACA 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 11 (5′ UCUAUCUUCAGGGUCAUCUGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 41 (5′ CAGAUGACCCUGAAGAUAGA 3′);

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 15 (5′ UUUUUGUUCAUUCUGAUUCCUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 45 (5′ GGAAUCAGAAUGAACAAAAA 3′);

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 22 (5′ UGAGUGUGAGACCUUGUCCAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 52 (5′ UGGACAAGGUCUCACACUCA 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 23 (5′ UCAGAGUGUGAGACCUUGUCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 53 (5′ GACAAGGUCUCACACUCUGA 3′); or

vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 27 (5′ UGUAGAACCGGGUACAGCUUUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 57 (5′ AAGCUGUACCCGGUUCUACA 3′).

30 . The isolated oligonucleotide of claim 7 , wherein the double stranded region comprises:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 3 (5′ UUAGUAGAAUUUCUCUGUAGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 33 (5′ CUACAGAGAAAUUCUACUAA 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 5 (5′ UAUGUAGUAGAAUUUCUCUGUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 35 (5′ CAGAGAAAUUCUACUACAUA 3′);

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 6 (5′ UGAUGUAGUAGAAUUUCUCUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 36 (5′ AGAGAAAUUCUACUACAUCA 3′);

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 9 (5′ UUUAUAGAUGUAGUAGAAUUUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 39 (5′ AAUUCUACUACAUCUAUAAA 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 12 (5′ UAAAAUAUAUUCAUGAGCUUCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 42 (5′ AAGCUCAUGAAUAUAUUUUA 3′);

vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 17 (5′ UAAGUCAAAGUCUUUUAGCUGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 47 (5′ AGCUAAAAGACUUUGACUUA 3′);

vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 18 (5′ UAAAGUCAAAGUCUUUUAGCUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 48 (5′ GCUAAAAGACUUUGACUUUA 3′);

viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 20 (5′ UAAUUUAUUACAGGUGAGUUGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 50 (5′ AACUCACCUGUAAUAAAUUA 3′);

ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 21 (5′ UCUGGUUUUAUGGUGACCUUGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 51 (5′ AAGGUCACCAUAAAACCAGA 3′);

x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 24 (5′ UUAUUGGUGAACUUUGAAAGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 54 (5′ CUUUCAAAGUUCACCAAUAA 3′);

xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 25 (5′ UUAAUAGGCGUAGACCUUGACU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 55 (5′ UCAAGGUCUACGCCUAUUAA 3′);

xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 28 (5′ UCAGAGCUUGUUCAGCUUUCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 58 (5′ GAAAGCUGAACAAGCUCUGA 3′); or

xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 30 (5′ UUAUGAAGCAAUUCUCCUCAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 60 (5′ UGAGGAGAAUUGCUUCAUAA 3′).

31 . The isolated oligonucleotide of claim 10 , wherein the double stranded region comprises:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 2 (5′ UGAGAAGACAAGGAGUCCUGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 32 (5′ CAGGACUCCUUGUCUUCUCA 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 4 (5′ UGUAGUAGAAUUUCUCUGUAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 34 (5′ UACAGAGAAAUUCUACUACA 3′);

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 7 (5′ UAUAGAUGUAGUAGAAUUUCUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 37 (5′ GAAAUUCUACUACAUCUAUA 3′);

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 8 (5′ UUAUAGAUGUAGUAGAAUUUCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 38 (5′ AAAUUCUACUACAUCUAUAA 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 13 (5′ UAUGAAGAAGUCCUGCAUUACU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 43 (5′ UAAUGCAGGACUUCUUCAUA 3′);

vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 14 (5′ UUUCGAACAACAGAGUAGGGUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 44 (5′ CCCUACUCUGUUGUUCGAAA 3′);

vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 16 (5′ UAAGUCUUUUAGCUGCAGUAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 46 (5′ UACUGCAGCUAAAAGACUUA 3′);

viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 19 (5′ UGUUCAUUGAGCCAACGCACGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 49 (5′ GUGCGUUGGCUCAAUGAACA 3′);

ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 26 (5′ UUUGUAAUAGGCGUAGACCUUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 56 (5′ AGGUCUACGCCUAUUACAAA 3′);

x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 29 (5′ UAUGAAGCAAUUCUCCUCAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 59 (5′ CUGAGGAGAAUUGCUUCAUA 3′); or

xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 31 (5′ UUUUGUAUGAAGCAAUUCUCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 61 (5′ GAGAAUUGCUUCAUACAAAA 3′).

32 .- 37 . (canceled)

38 . An isolated oligonucleotide comprising a sense strand and an antisense strand, wherein:

the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising 19-25 nucleotides between any one of the nucleotide positions selected from:

a) 33 to 53;

b) 237 to 260;

c) 444 to 480;

d) 583 to 879;

e) 1118 to 1328;

f) 1409 to 1542;

g) 1619 to 1648;

h) 1754 to 1816;

i) 2232 to 2256;

j) 2300 to 2368;

k) 2423 to 2452;

l) 2518 to 2726;

m) 2860 to 2883;

n) 2981 to 3043;

o) 3125 to 3239;

p) 3298 to 3437;

q) 3567 to 3638;

r) 3767 to 3913;

s) 3985 to 4430; and

t) 4490 to 5054,

from the 5′ end of a C3 mRNA sequence according to SEQ ID NO: 1,

and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double stranded region.

39 . (canceled)

40 . The isolated oligonucleotide of claim 38 , wherein the double stranded region comprises:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 71 (5′ UGUAGAUGGUCUUGUCUGUCUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 236 (5′ GACAGACAAGACCAUCUACA 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 106 (5′ UUGAUGCUCAAGGGCUUCUGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 271 (5′ CAGAAGCCCUUGAGCAUCAA 3′);

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 97 (5′ UAAGAUGACAAAGGCAGUUCCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 262 (5′ GAACUGCCUUUGUCAUCUUA 3′);

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 168 (5′ UCAAAGUCAAAGUCUUUUAGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 333 (5′ CUAAAAGACUUUGACUUUGA 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 115 (5′ UGAAGGAAGGGAUGAAGUCGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 280 (5′ CGACUUCAUCCCUUCCUUCA 3′);

vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 173 (5′ UCUUUUGGUAUUGAGCCAAGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 338 (5′ CUUGGCUCAAUACCAAAAGA 3′);

vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 116 (5′ UUUCUGACUGGCCGCUUUUUAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 281 (5′ AAAAAGCGGCCAGUCAGAAA 3′);

viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 169 (5′ UCACAAAGUCAAAGUCUUUUAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 334 (5′ AAAAGACUUUGACUUUGUGA 3′);

ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 66 (5′ UGUUUUUUGCCUGGGAAGUCGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 231 (5′ GACUUCCCAGGCAAAAAACA 3′);

x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 153 (5′ UUGAAGGCCAGCUGCUGGGUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 318 (5′ ACCCAGCAGCUGGCCUUCAA 3′);

xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 189 (5′ UCUGUUUCCGGUGCUGGUUUUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 354 (5′ AAACCAGCACCGGAAACAGA 3′);

xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 103 (5′ UUGUUGAUGCUGAGUUUGGCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 268 (5′ GCCAAACUCAGCAUCAACAA 3′);

xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 225 (5′ UGUCCAACCUGCACCUCAUCCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 390 (5′ GAUGAGGUGCAGGUUGGACA 3′);

xiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 117 (5′ UAUCUUCAGGGUCAUCUGCUGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 282 (5′ AGCAGAUGACCCUGAAGAUA 3′);

xv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 81 (5′ UCAUAGUAGGCUCGGAUCUUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 246 (5′ AAGAUCCGAGCCUACUAUGA 3′);

xvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 133 (5′ UGUUUCGAACAACAGAGUAGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 298 (5′ CUACUCUGUUGUUCGAAACA 3′);

xvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 107 (5′ UCAGGUAAUUGUUGGAGUUGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 272 (5′ CAACUCCAACAAUUACCUGA 3′);

xviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 68 (5′ UGUCUGUCUGGAUGAAGAGGUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 233 (5′ CCUCUUCAUCCAGACAGACA 3′);

xix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 222 (5′ UGUACUCGUCAAAGUCAUUGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 387 (5′ CAAUGACUUUGACGAGUACA 3′);

xx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 139 (5′ UGGAUUGUGGAGUAGUUCCACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 304 (5′ UGGAACUACUCCACAAUCCA 3′);

xxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 158 (5′ UGGAAGUCUCCUGCUUUAGUGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 323 (5′ ACUAAAGCAGGAGACUUCCA 3′);

xxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 83 (5′ UUUUCAUAGUAGGCUCGGAUCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 248 (5′ AUCCGAGCCUACUAUGAAAA 3′);

xxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 156 (5′ UCAGGAUCAGCCAUUUAACAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 321 (5′ UGUUAAAUGGCUGAUCCUGA 3′);

xxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 208 (5′ UCUUGUCCAGGUAGAUGAUGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 373 (5′ CAUCAUCUACCUGGACAAGA 3′);

xxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 62 (5′ UGACAGUGCAGGGUCAGAGGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 227 (5′ CCUCUGACCCUGCACUGUCA 3′);

xxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 202 (5′ UCUAUCGGAGAAGGCUUUGUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 367 (5′ ACAAAGCCUUCUCCGAUAGA 3′);

xxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 80 (5′ UCUUCCACUGGCCCAUGUUGAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 245 (5′ CAACAUGGGCCAGUGGAAGA 3′);

xxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 174 (5′ UGAUUCCCAGUGGAUACGGUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 339 (5′ ACCGUAUCCACUGGGAAUCA 3′);

xxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 65 (5′ UUUUUUUGCCUGGGAAGUCGUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 230 (5′ CGACUUCCCAGGCAAAAAAA 3′);

xxx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 214 (5′ UGGUUGUAAUAGGCGUAGACCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 379 (5′ GUCUACGCCUAUUACAACCA 3′);

xxxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 141 (5′ UCUGCAGAAGGCUGGAUUGUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 306 (5′ ACAAUCCAGCCUUCUGCAGA 3′);

xxxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 91 (5′ UCUCUGUAGGCUCCACUAUGAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 256 (5′ CAUAGUGGAGCCUACAGAGA 3′);

xxxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 88 (5′ UGAAACUGGGCAGCACGUACUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 253 (5′ GUACGUGCUGCCCAGUUUCA 3′);

xxxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 165 (5′ UCUGCAGUAGGGCCAAGAGGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 330 (5′ CCUCUUGGCCCUACUGCAGA 3′);

xxxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 140 (5′ UCUGGAUUGUGGAGUAGUUCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 305 (5′ GAACUACUCCACAAUCCAGA 3′);

xxxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 183 (5′ UCUUUUCCUUCAGCUGUGACUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 348 (5′ GUCACAGCUGAAGGAAAAGA 3′);

xxxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 179 (5′ UCUGUGAAACCCUCAUUUUCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 344 (5′ GAAAAUGAGGGUUUCACAGA 3′);

xxxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 127 (5′ UCAUUACUGUGACCUCGAAGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 292 (5′ CUUCGAGGUCACAGUAAUGA 3′);

xxxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 185 (5′ UGAGGUCGAAUUUAUUACAGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 350 (5′ CUGUAAUAAAUUCGACCUCA 3′);

xL) an antisense strand of nucleic acid sequence according to SEQ ID NO: 111 (5′ UCAUUCGCAGGAGGAAGUUGAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 276 (5′ CAACUUCCUCCUGCGAAUGA 3′);

xLi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 157 (5′ UGUAUCACGGGCGCAUCCUCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 322 (5′ GAGGAUGCGCCCGUGAUACA 3′);

xLii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 164 (5′ UCAGCAAUGGCCACAGUGUAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 329 (5′ UACACUGUGGCCAUUGCUGA 3′);

xLiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 90 (5′ UCACUAUGACCUCGAAACUGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 255 (5′ CAGUUUCGAGGUCAUAGUGA 3′);

xLiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 87 (5′ UGUACUCCUUCACCUCAAACUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 252 (5′ GUUUGAGGUGAAGGAGUACA 3′);

xLv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 199 (5′ UCUCAUACUUGGAGAUGUAUCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 364 (5′ AUACAUCUCCAAGUAUGAGA 3′);

xLvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 184 (5′ UCUUAGCAUGGUACAUUGUCAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 349 (5′ GACAAUGUACCAUGCUAAGA 3′);

xLvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 400 (5′ UUGUAGUUGCAGCAGUCCAGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 426 (5′ CUGGACUGCUGCAACUACAA 3′);

xLiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 110 (5′ UGAGGAAGUUGACGUUGAGGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 275 (5′ CCUCAACGUCAACUUCCUCA 3′);

xLix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 147 (5′ UGGCAUCCUCUGUCAUCUGGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 312 (5′ CCAGAUGACAGAGGAUGCCA 3′);

L) an antisense strand of nucleic acid sequence according to SEQ ID NO: 218 (5′ UUUUUGUAUGAAGCAAUUCUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 383 (5′ AGAAUUGCUUCAUACAAAAA 3′);

Li) an antisense strand of nucleic acid sequence according to SEQ ID NO: 138 (5′ UGAUUGUGGAGUAGUUCCACCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 303 (5′ GUGGAACUACUCCACAAUCA 3′);

Lii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 114 (5′ UGAUGAAGUCGGUGGUGAUGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 279 (5′ CAUCACCACCGACUUCAUCA 3′);

Liii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 85 (5′ UCUCCUUCACCUCAAACUCAGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 250 (5′ UGAGUUUGAGGUGAAGGAGA 3′);

Liv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 152 (5′ UCUUCUUGAUGAGCUCCAAGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 317 (5′ CUUGGAGCUCAUCAAGAAGA 3′);

Lv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 402 (5′ UCUCAUCCAGGUUACUCCUGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 428 (5′ CAGGAGUAACCUGGAUGAGA 3′);

Lvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 136 (5′ UCUUGGUUCUGCCGGUAAUUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 301 (5′ AAUUACCGGCAGAACCAAGA 3′);

Lvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 209 (5′ UGACCUUGUCCAGGUAGAUGAU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 374 (5′ CAUCUACCUGGACAAGGUCA 3′); or

Lviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 412 (5′ UCUCUGGGAACUCACUUCGGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 438 (5′ CCGAAGUGAGUUCCCAGAGA 3′).

41 . (canceled)

42 . The isolated oligonucleotide of claim 38 , wherein the double stranded region comprises:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 94 (5′ UUAGAUGUAGUAGAAUUUCUCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 259 (5′ AGAAAUUCUACUACAUCUAA 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 74 (5′ UGACAAGGAGUCCUGCUUGACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 239 (5′ UCAAGCAGGACUCCUUGUCA 3′);

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 70 (5′ UUAGAUGGUCUUGUCUGUCUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 235 (5′ AGACAGACAAGACCAUCUAA 3′);

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 64 (5′ UUUUUUGCCUGGGAAGUCGUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 229 (5′ ACGACUUCCCAGGCAAAAAA 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 172 (5′ UUAGUAUCUCUGUUCAUUGAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 337 (5′ UCAAUGAACAGAGAUACUAA 3′);

vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 226 (5′ UGUCAGUUGGGGCACCCAAAGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 391 (5′ UUUGGGUGCCCCAACUGACA 3′);

vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 217 (5′ UUUGUAUGAAGCAAUUCUCCUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 382 (5′ GGAGAAUUGCUUCAUACAAA 3′);

viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 131 (5′ UGAACAACAGAGUAGGGUAGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 296 (5′ CUACCCUACUCUGUUGUUCA 3′);

ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 113 (5′ UAUCAGGUAGGUGUAGUAGCGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 278 (5′ GCUACUACACCUACCUGAUA 3′);

x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 126 (5′ UAUUACUGUGACCUCGAAGGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 291 (5′ CCUUCGAGGUCACAGUAAUA 3′);

xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 146 (5′ UGAAUUCUGGUCUCAGACUCGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 311 (5′ GAGUCUGAGACCAGAAUUCA 3′);

xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 170 (5′ UGUAUCUCUGUUCAUUGAGCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 335 (5′ GCUCAAUGAACAGAGAUACA 3′);

xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 123 (5′ UUUUCAAAAAUAUAUUCAUGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 288 (5′ CAUGAAUAUAUUUUUGAAAA 3′);

xiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 93 (5′ UAGUAGAAUUUCUCUGUAGGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 258 (5′ CCUACAGAGAAAUUCUACUA 3′);

xv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 124 (5′ UCUUUCAAAAAUAUAUUCAUGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 289 (5′ AUGAAUAUAUUUUUGAAAGA 3′);

xvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 198 (5′ UCAUACUUGGAGAUGUAUCUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 363 (5′ AGAUACAUCUCCAAGUAUGA 3′);

xvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 145 (5′ UAAUUCUGGUCUCAGACUCGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 310 (5′ CGAGUCUGAGACCAGAAUUA 3′);

xviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 188 (5′ UGUUUUAUGGUGACCUUGAGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 353 (5′ CUCAAGGUCACCAUAAAACA 3′);

xix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 67 (5′ UCUGUCUGGAUGAAGAGGUACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 232 (5′ UACCUCUUCAUCCAGACAGA 3′);

xx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 72 (5′ UUGUAGAUGGUCUUGUCUGUCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 237 (5′ ACAGACAAGACCAUCUACAA 3′);

xxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 159 (5′ UAAGGAAGUCUCCUGCUUUAGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 324 (5′ UAAAGCAGGAGACUUCCUUA 3′);

xxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 181 (5′ UUUCCUUCAGCUGUGACUGUGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 346 (5′ ACAGUCACAGCUGAAGGAAA 3′);

xxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 108 (5′ UGAGAUGCAGGUAAUUGUUGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 273 (5′ CAACAAUUACCUGCAUCUCA 3′);

xxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 96 (5′ UAGAUGACAAAGGCAGUUCCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 261 (5′ GGAACUGCCUUUGUCAUCUA 3′);

xxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 129 (5′ UGAAGAAGUCCUGCAUUACUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 294 (5′ AGUAAUGCAGGACUUCUUCA 3′);

xxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 196 (5′ UUACUUGGAGAUGUAUCUGUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 361 (5′ ACAGAUACAUCUCCAAGUAA 3′);

xxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 122 (5′ UUUCAAAAAUAUAUUCAUGAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 287 (5′ UCAUGAAUAUAUUUUUGAAA 3′);

xxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 160 (5′ UUUCAUGUAGUUGGCUUCAAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 325 (5′ UUGAAGCCAACUACAUGAAA 3′);

xxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 162 (5′ UAUCUCUGUAGGUUCAUGUAGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 327 (5′ UACAUGAACCUACAGAGAUA 3′);

xxx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 104 (5′ UGUGUUGAUGCUGAGUUUGGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 269 (5′ CCAAACUCAGCAUCAACACA 3′);

xxxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 201 (5′ UCUUUGUCCAGCUCAUACUUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 366 (5′ AAGUAUGAGCUGGACAAAGA 3′);

xxxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 63 (5′ UUUUUGCCUGGGAAGUCGUGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 228 (5′ CACGACUUCCCAGGCAAAAA 3′);

xxxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 178 (5′ UCAUUUUCCUUGGUCUCUUCUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 343 (5′ GAAGAGACCAAGGAAAAUGA 3′);

xxxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 203 (5′ UUUCCUAUCGGAGAAGGCUUUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 368 (5′ AAGCCUUCUCCGAUAGGAAA 3′);

xxxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 216 (5′ UGAAGCAAUUCUCCUCAGCACA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 381 (5′ UGCUGAGGAGAAUUGCUUCA 3′);

xxxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 220 (5′ UGUACACAUAGUCCACUCCUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 385 (5′ AGGAGUGGACUAUGUGUACA 3′);

xxxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 118 (5′ UUAUCUUCAGGGUCAUCUGCUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 283 (5′ GCAGAUGACCCUGAAGAUAA 3′);

xxxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 194 (5′ UUAGACAUAGUGGCAUCCUGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 359 (5′ CAGGAUGCCACUAUGUCUAA 3′);

xxxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 219 (5′ UUACACAUAGUCCACUCCUGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 384 (5′ CAGGAGUGGACUAUGUGUAA 3′);

xL) an antisense strand of nucleic acid sequence according to SEQ ID NO: 99 (5′ UGUCUUGGUGAAGUGGAUCUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 264 (5′ AGAUCCACUUCACCAAGACA 3′);

xLi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 154 (5′ UAAGACCUUGACCACGUAGGCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 319 (5′ CCUACGUGGUCAAGGUCUUA 3′);

xLii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 171 (5′ UAGUAUCUCUGUUCAUUGAGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 336 (5′ CUCAAUGAACAGAGAUACUA 3′);

xLiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 195 (5′ UCAGUCAUCAUGGAUAUGUCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 360 (5′ GACAUAUCCAUGAUGACUGA 3′);

xLiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 73 (5′ UGUGUAGAUGGUCUUGUCUGUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 238 (5′ CAGACAAGACCAUCUACACA 3′);

xLv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 180 (5′ UUUCAGCUGUGACUGUGAAACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 345 (5′ UUUCACAGUCACAGCUGAAA 3′);

xLvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 92 (5′ UUUCUCUGUAGGCUCCACUAUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 257 (5′ UAGUGGAGCCUACAGAGAAA 3′);

xLvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 75 (5′ UAAGACAAGGAGUCCUGCUUGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 240 (5′ AAGCAGGACUCCUUGUCUUA 3′);

xLviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 137 (5′ UGUAGUUCCACCCUCACCUUGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 302 (5′ AAGGUGAGGGUGGAACUACA 3′);

xLix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 89 (5′ UCUAUGACCUCGAAACUGGGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 254 (5′ CCCAGUUUCGAGGUCAUAGA 3′);

L) an antisense strand of nucleic acid sequence according to SEQ ID NO: 130 (5′ UGAUGAAGAAGUCCUGCAUUAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 295 (5′ AAUGCAGGACUUCUUCAUCA 3′);

Li) an antisense strand of nucleic acid sequence according to SEQ ID NO: 69 (5′ UUUGUCUGUCUGGAUGAAGAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 234 (5′ UCUUCAUCCAGACAGACAAA 3′);

Lii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 176 (5′ UUUUUCCUUGGUCUCUUCUGAU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 341 (5′ CAGAAGAGACCAAGGAAAAA 3′);

Liii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 100 (5′ UGAGGUCAAAGGGCAUUCCUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 265 (5′ AGGAAUGCCCUUUGACCUCA 3′);

Liv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 82 (5′ UUUCAUAGUAGGCUCGGAUCUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 247 (5′ GAUCCGAGCCUACUAUGAAA 3′);

Lv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 212 (5′ UGUAAUAGGCGUAGACCUUGAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 377 (5′ CAAGGUCUACGCCUAUUACA 3′);

Lvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 191 (5′ UAUCAUAGUGUUCUUGGCAUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 356 (5′ AUGCCAAGAACACUAUGAUA 3′);

Lvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 161 (5′ UUGUAGGUUCAUGUAGUUGGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 326 (5′ CCAACUACAUGAACCUACAA 3′);

Lviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 112 (5′ UGUGUAGUAGCGGAUCUUGGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 277 (5′ CCAAGAUCCGCUACUACACA 3′);

Lix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 151 (5′ UUUCUUGAUGAGCUCCAAGGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 316 (5′ CCUUGGAGCUCAUCAAGAAA 3′);

Lx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 213 (5′ UGUUGUAAUAGGCGUAGACCUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 378 (5′ GGUCUACGCCUAUUACAACA 3′);

Lxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 206 (5′ UGAUGAUGAGGGUGUUCCUAUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 371 (5′ UAGGAACACCCUCAUCAUCA 3′);

Lxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 155 (5′ UGAGAGAAGACCUUGACCACGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 320 (5′ GUGGUCAAGGUCUUCUCUCA 3′);

Lxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 143 (5′ UUUGUUCAUUCUGAUUCCUUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 308 (5′ AAGGAAUCAGAAUGAACAAA 3′);

Lxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 193 (5′ UCAAGGAUCAUAGUGUUCUUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 358 (5′ AAGAACACUAUGAUCCUUGA 3′);

Lxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 163 (5′ UCAGUGUAGGAUCUCUGUAGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 328 (5′ CUACAGAGAUCCUACACUGA 3′);

Lxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 149 (5′ UUUCAUCCAGGUAAUGCACAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 314 (5′ UGUGCAUUACCUGGAUGAAA 3′);

Lxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 200 (5′ UUUUGUCCAGCUCAUACUUGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 365 (5′ CAAGUAUGAGCUGGACAAAA 3′);

Lxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 210 (5′ UCUCAGAGUGUGAGACCUUGUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 375 (5′ CAAGGUCUCACACUCUGAGA 3′);

Lxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 215 (5′ UUGUUCAGCUUUCCAUCCUCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 380 (5′ GAGGAUGGAAAGCUGAACAA 3′);

Lxx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 98 (5′ UCUUGGUGAAGUGGAUCUGGUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 263 (5′ CCAGAUCCACUUCACCAAGA 3′);

Lxxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 182 (5′ UUUUUCCUUCAGCUGUGACUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 347 (5′ AGUCACAGCUGAAGGAAAAA 3′);

Lxxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 150 (5′ UGUUUCAUCCAGGUAAUGCACA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 315 (5′ UGCAUUACCUGGAUGAAACA 3′);

Lxxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 223 (5′ UAUGAUGUACUCGUCAAAGUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 388 (5′ ACUUUGACGAGUACAUCAUA 3′);

Lxxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 177 (5′ UAUUUUCCUUGGUCUCUUCUGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 342 (5′ AGAAGAGACCAAGGAAAAUA 3′);

Lxxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 128 (5′ UGAAGUCCUGCAUUACUGUGAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 293 (5′ CACAGUAAUGCAGGACUUCA 3′);

Lxxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 224 (5′ UCUCAUCCGAGCCUGACUUGAU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 389 (5′ CAAGUCAGGCUCGGAUGAGA 3′);

Lxxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 205 (5′ UAUGAUGAGGGUGUUCCUAUCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 370 (5′ AUAGGAACACCCUCAUCAUA 3′);

Lxxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 186 (5′ UUUUAUGGUGACCUUGAGGUCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 351 (5′ ACCUCAAGGUCACCAUAAAA 3′);

Lxxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 77 (5′ UGACGAGUUCCGGAAUGUCCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 242 (5′ GGACAUUCCGGAACUCGUCA 3′);

Lxxx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 197 (5′ UAUACUUGGAGAUGUAUCUGUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 362 (5′ CAGAUACAUCUCCAAGUAUA 3′);

Lxxxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 95 (5′ UGUUAUAGAUGUAGUAGAAUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 260 (5′ AUUCUACUACAUCUAUAACA 3′);

Lxxxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 78 (5′ UUUGACGAGUUCCGGAAUGUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 243 (5′ ACAUUCCGGAACUCGUCAAA 3′);

Lxxxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 101 (5′ UAACACCAUGAGGUCAAAGGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 266 (5′ CCUUUGACCUCAUGGUGUUA 3′);

Lxxxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 79 (5′ UGUUGACGAGUUCCGGAAUGUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 244 (5′ CAUUCCGGAACUCGUCAACA 3′);

Lxxxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 221 (5′ UGUCUUGUACACAUAGUCCACU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 386 (5′ UGGACUAUGUGUACAAGACA 3′);

Lxxxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 167 (5′ UGUCUUUUAGCUGCAGUAGGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 332 (5′ CCUACUGCAGCUAAAAGACA 3′);

Lxxxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 84 (5′ UCAAACUCAGUGGAGAAGACCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 249 (5′ GUCUUCUCCACUGAGUUUGA 3′);

Lxxxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 144 (5′ UGUUUUGUUCAUUCUGAUUCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 309 (5′ GAAUCAGAAUGAACAAAACA 3′);

Lxxxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 166 (5′ UUCUUUUAGCUGCAGUAGGGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 331 (5′ CCCUACUGCAGCUAAAAGAA 3′);

xc) an antisense strand of nucleic acid sequence according to SEQ ID NO: 76 (5′ UUUCUGAGAAGACAAGGAGUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 241 (5′ ACUCCUUGUCUUCUCAGAAA 3′);

xci) an antisense strand of nucleic acid sequence according to SEQ ID NO: 204 (5′ UGUGUUCCUAUCGGAGAAGGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 369 (5′ CCUUCUCCGAUAGGAACACA 3′);

xcii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 211 (5′ UCAUCCUCAGAGUGUGAGACCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 376 (5′ GUCUCACACUCUGAGGAUGA 3′);

xciii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 132 (5′ UUUUCGAACAACAGAGUAGGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 297 (5′ CCUACUCUGUUGUUCGAAAA 3′);

xciv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 142 (5′ UGGAUGGUUACGGUCUGCUGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 307 (5′ CAGCAGACCGUAACCAUCCA 3′);

xcv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 148 (5′ UCAGGUAAUGCACAGCGAUGAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 313 (5′ CAUCGCUGUGCAUUACCUGA 3′);

xcvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 207 (5′ UGUAGAUGAUGAGGGUGUUCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 372 (5′ GAACACCCUCAUCAUCUACA 3′);

xcvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 86 (5′ UUACUCCUUCACCUCAAACUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 251 (5′ AGUUUGAGGUGAAGGAGUAA 3′);

xcviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 192 (5′ UAAGGAUCAUAGUGUUCUUGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 357 (5′ CAAGAACACUAUGAUCCUUA 3′);

xcix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 175 (5′ UCAGAUUCCCAGUGGAUACGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 340 (5′ CGUAUCCACUGGGAAUCUGA 3′);

c) an antisense strand of nucleic acid sequence according to SEQ ID NO: 187 (5′ UUUUUAUGGUGACCUUGAGGUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 352 (5′ CCUCAAGGUCACCAUAAAAA 3′);

ci) an antisense strand of nucleic acid sequence according to SEQ ID NO: 109 (5′ UCUGAGAGAUGCAGGUAAUUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 274 (5′ AAUUACCUGCAUCUCUCAGA 3′);

cii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 102 (5′ UGACUCGGUAGGCUGGAGAGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 267 (5′ CUCUCCAGCCUACCGAGUCA 3′);

ciii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 121 (5′ UCAAAAAUAUAUUCAUGAGCUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 286 (5′ GCUCAUGAAUAUAUUUUUGA 3′);

civ) an antisense strand of nucleic acid sequence according to SEQ ID NO: 134 (5′ UGAUUUCCACCUGCUCGUUUCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 299 (5′ AAACGAGCAGGUGGAAAUCA 3′);

cv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 135 (5′ UUUGGUUCUGCCGGUAAUUGUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 300 (5′ CAAUUACCGGCAGAACCAAA 3′);

cvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 105 (5′ UGAUGCUCAAGGGCUUCUGGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 270 (5′ CCAGAAGCCCUUGAGCAUCA 3′);

cvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 125 (5′ UGUCUUUCAAAAAUAUAUUCAU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 290 (5′ GAAUAUAUUUUUGAAAGACA 3′);

cviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 190 (5′ UGUGUUCUUGGCAUCCUGAGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 355 (5′ CUCAGGAUGCCAAGAACACA 3′);

cix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 119 (5′ UAUGUAGUUGCAGCAGUCCAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 284 (5′ UGGACUGCUGCAACUACAUA 3′);

cx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 120 (5′ UGUGAUGUAGUUGCAGCAGUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 285 (5′ ACUGCUGCAACUACAUCACA 3′); or

cxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 394 (5′ UAAAUAUAUUCAUGAGCUUCGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 420 (5′ GAAGCUCAUGAAUAUAUUUA 3′).

43 . (canceled)

44 . The isolated oligonucleotide of claim 38 , wherein the double stranded region comprises:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 96 (5′ UAGAUGACAAAGGCAGUUCCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 261 (5′ GGAACUGCCUUUGUCAUCUA 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 217 (5′ UUUGUAUGAAGCAAUUCUCCUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 382 (5′ GGAGAAUUGCUUCAUACAAA 3′);

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 70 (5′ UUAGAUGGUCUUGUCUGUCUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 235 (5′ AGACAGACAAGACCAUCUAA 3′);

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 198 (5′ UCAUACUUGGAGAUGUAUCUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 363 (5′ AGAUACAUCUCCAAGUAUGA 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 113 (5′ UAUCAGGUAGGUGUAGUAGCGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 278 (5′ GCUACUACACCUACCUGAUA 3′);

vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 126 (5′ UAUUACUGUGACCUCGAAGGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 291 (5′ CCUUCGAGGUCACAGUAAUA 3′);

vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 170 (5′ UGUAUCUCUGUUCAUUGAGCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 335 (5′ GCUCAAUGAACAGAGAUACA 3′);

viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 123 (5′ UUUUCAAAAAUAUAUUCAUGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 288 (5′ CAUGAAUAUAUUUUUGAAAA 3′);

ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 226 (5′ UGUCAGUUGGGGCACCCAAAGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 391 (5′ UUUGGGUGCCCCAACUGACA 3′);

x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 67 (5′ UCUGUCUGGAUGAAGAGGUACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 232 (5′ UACCUCUUCAUCCAGACAGA 3′);

xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 172 (5′ UUAGUAUCUCUGUUCAUUGAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 337 (5′ UCAAUGAACAGAGAUACUAA 3′);

xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 74 (5′ UGACAAGGAGUCCUGCUUGACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 239 (5′ UCAAGCAGGACUCCUUGUCA 3′);

xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 64 (5′ UUUUUUGCCUGGGAAGUCGUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 229 (5′ ACGACUUCCCAGGCAAAAAA 3′);

xiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 181 (5′ UUUCCUUCAGCUGUGACUGUGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 346 (5′ ACAGUCACAGCUGAAGGAAA 3′);

xv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 131 (5′ UGAACAACAGAGUAGGGUAGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 296 (5′ CUACCCUACUCUGUUGUUCA 3′);

xvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 196 (5′ UUACUUGGAGAUGUAUCUGUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 361 (5′ ACAGAUACAUCUCCAAGUAA 3′);

xvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 129 (5′ UGAAGAAGUCCUGCAUUACUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 294 (5′ AGUAAUGCAGGACUUCUUCA 3′);

xviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 212 (5′ UGUAAUAGGCGUAGACCUUGAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 377 (5′ CAAGGUCUACGCCUAUUACA 3′);

xix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 93 (5′ UAGUAGAAUUUCUCUGUAGGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 258 (5′ CCUACAGAGAAAUUCUACUA 3′);

xx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 194 (5′ UUAGACAUAGUGGCAUCCUGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 359 (5′ CAGGAUGCCACUAUGUCUAA 3′);

xxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 154 (5′ UAAGACCUUGACCACGUAGGCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 319 (5′ CCUACGUGGUCAAGGUCUUA 3′);

xxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 108 (5′ UGAGAUGCAGGUAAUUGUUGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 273 (5′ CAACAAUUACCUGCAUCUCA 3′);

xxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 72 (5′ UUGUAGAUGGUCUUGUCUGUCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 237 (5′ ACAGACAAGACCAUCUACAA 3′);

xxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 78 (5′ UUUGACGAGUUCCGGAAUGUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 243 (5′ ACAUUCCGGAACUCGUCAAA 3′);

xxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 211 (5′ UCAUCCUCAGAGUGUGAGACCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 376 (5′ GUCUCACACUCUGAGGAUGA 3′);

xxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 188 (5′ UGUUUUAUGGUGACCUUGAGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 353 (5′ CUCAAGGUCACCAUAAAACA 3′);

xxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 124 (5′ UCUUUCAAAAAUAUAUUCAUGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 289 (5′ AUGAAUAUAUUUUUGAAAGA 3′);

xxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 159 (5′ UAAGGAAGUCUCCUGCUUUAGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 324 (5′ UAAAGCAGGAGACUUCCUUA 3′);

xxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 208 (5′ UCUUGUCCAGGUAGAUGAUGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 373 (5′ CAUCAUCUACCUGGACAAGA 3′);

xxx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 137 (5′ UGUAGUUCCACCCUCACCUUGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 302 (5′ AAGGUGAGGGUGGAACUACA 3′);

xxxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 122 (5′ UUUCAAAAAUAUAUUCAUGAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 287 (5′ UCAUGAAUAUAUUUUUGAAA 3′);

xxxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 63 (5′ UUUUUGCCUGGGAAGUCGUGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 228 (5′ CACGACUUCCCAGGCAAAAA 3′);

xxxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 219 (5′ UUACACAUAGUCCACUCCUGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 384 (5′ CAGGAGUGGACUAUGUGUAA 3′);

xxxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 195 (5′ UCAGUCAUCAUGGAUAUGUCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 360 (5′ GACAUAUCCAUGAUGACUGA 3′);

xxxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 95 (5′ UGUUAUAGAUGUAGUAGAAUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 260 (5′ AUUCUACUACAUCUAUAACA 3′);

xxxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 146 (5′ UGAAUUCUGGUCUCAGACUCGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 311 (5′ GAGUCUGAGACCAGAAUUCA 3′);

xxxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 220 (5′ UGUACACAUAGUCCACUCCUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 385 (5′ AGGAGUGGACUAUGUGUACA 3′);

xxxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 151 (5′ UUUCUUGAUGAGCUCCAAGGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 316 (5′ CCUUGGAGCUCAUCAAGAAA 3′);

xxxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 118 (5′ UUAUCUUCAGGGUCAUCUGCUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 283 (5′ GCAGAUGACCCUGAAGAUAA 3′);

xL) an antisense strand of nucleic acid sequence according to SEQ ID NO: 180 (5′ UUUCAGCUGUGACUGUGAAACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 345 (5′ UUUCACAGUCACAGCUGAAA 3′);

xLi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 210 (5′ UCUCAGAGUGUGAGACCUUGUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 375 (5′ CAAGGUCUCACACUCUGAGA 3′);

xLii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 187 (5′ UUUUUAUGGUGACCUUGAGGUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 352 (5′ CCUCAAGGUCACCAUAAAAA 3′);

xLiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 162 (5′ UAUCUCUGUAGGUUCAUGUAGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 327 (5′ UACAUGAACCUACAGAGAUA 3′);

xLiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 145 (5′ UAAUUCUGGUCUCAGACUCGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 310 (5′ CGAGUCUGAGACCAGAAUUA 3′);

xLv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 201 (5′ UCUUUGUCCAGCUCAUACUUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 366 (5′ AAGUAUGAGCUGGACAAAGA 3′);

xLvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 81 (5′ UCAUAGUAGGCUCGGAUCUUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 246 (5′ AAGAUCCGAGCCUACUAUGA 3′);

xLvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 206 (5′ UGAUGAUGAGGGUGUUCCUAUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 371 (5′ UAGGAACACCCUCAUCAUCA 3′);

xLviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 215 (5′ UUGUUCAGCUUUCCAUCCUCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 380 (5′ GAGGAUGGAAAGCUGAACAA 3′);

xLix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 213 (5′ UGUUGUAAUAGGCGUAGACCUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 378 (5′ GGUCUACGCCUAUUACAACA 3′);

L) an antisense strand of nucleic acid sequence according to SEQ ID NO: 189 (5′ UCUGUUUCCGGUGCUGGUUUUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 354 (5′ AAACCAGCACCGGAAACAGA 3′);

Li) an antisense strand of nucleic acid sequence according to SEQ ID NO: 207 (5′ UGUAGAUGAUGAGGGUGUUCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 372 (5′ GAACACCCUCAUCAUCUACA 3′);

Lii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 139 (5′ UGGAUUGUGGAGUAGUUCCACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 304 (5′ UGGAACUACUCCACAAUCCA 3′);

Liii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 143 (5′ UUUGUUCAUUCUGAUUCCUUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 308 (5′ AAGGAAUCAGAAUGAACAAA 3′);

Liv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 178 (5′ UCAUUUUCCUUGGUCUCUUCUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 343 (5′ GAAGAGACCAAGGAAAAUGA 3′);

Lv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 128 (5′ UGAAGUCCUGCAUUACUGUGAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 293 (5′ CACAGUAAUGCAGGACUUCA 3′);

Lvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 160 (5′ UUUCAUGUAGUUGGCUUCAAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 325 (5′ UUGAAGCCAACUACAUGAAA 3′);

Lvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 176 (5′ UUUUUCCUUGGUCUCUUCUGAU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 341 (5′ CAGAAGAGACCAAGGAAAAA 3′);

Lviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 80 (5′ UCUUCCACUGGCCCAUGUUGAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 245 (5′ CAACAUGGGCCAGUGGAAGA 3′);

Lix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 203 (5′ UUUCCUAUCGGAGAAGGCUUUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 368 (5′ AAGCCUUCUCCGAUAGGAAA 3′);

Lx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 87 (5′ UGUACUCCUUCACCUCAAACUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 252 (5′ GUUUGAGGUGAAGGAGUACA 3′);

Lxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 104 (5′ UGUGUUGAUGCUGAGUUUGGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 269 (5′ CCAAACUCAGCAUCAACACA 3′);

Lxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 69 (5′ UUUGUCUGUCUGGAUGAAGAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 234 (5′ UCUUCAUCCAGACAGACAAA 3′);

Lxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 197 (5′ UAUACUUGGAGAUGUAUCUGUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 362 (5′ CAGAUACAUCUCCAAGUAUA 3′);

Lxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 223 (5′ UAUGAUGUACUCGUCAAAGUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 388 (5′ ACUUUGACGAGUACAUCAUA 3′);

Lxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 142 (5′ UGGAUGGUUACGGUCUGCUGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 307 (5′ CAGCAGACCGUAACCAUCCA 3′);

Lxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 138 (5′ UGAUUGUGGAGUAGUUCCACCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 303 (5′ GUGGAACUACUCCACAAUCA 3′);

Lxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 75 (5′ UAAGACAAGGAGUCCUGCUUGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 240 (5′ AAGCAGGACUCCUUGUCUUA 3′);

Lxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 163 (5′ UCAGUGUAGGAUCUCUGUAGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 328 (5′ CUACAGAGAUCCUACACUGA 3′);

Lxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 116 (5′ UUUCUGACUGGCCGCUUUUUAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 281 (5′ AAAAAGCGGCCAGUCAGAAA 3′);

Lxx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 112 (5′ UGUGUAGUAGCGGAUCUUGGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 277 (5′ CCAAGAUCCGCUACUACACA 3′);

Lxxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 204 (5′ UGUGUUCCUAUCGGAGAAGGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 369 (5′ CCUUCUCCGAUAGGAACACA 3′);

Lxxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 169 (5′ UCACAAAGUCAAAGUCUUUUAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 334 (5′ AAAAGACUUUGACUUUGUGA 3′);

Lxxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 99 (5′ UGUCUUGGUGAAGUGGAUCUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 264 (5′ AGAUCCACUUCACCAAGACA 3′);

Lxxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 140 (5′ UCUGGAUUGUGGAGUAGUUCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 305 (5′ GAACUACUCCACAAUCCAGA 3′);

Lxxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 130 (5′ UGAUGAAGAAGUCCUGCAUUAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 295 (5′ AAUGCAGGACUUCUUCAUCA 3′);

Lxxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 68 (5′ UGUCUGUCUGGAUGAAGAGGUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 233 (5′ CCUCUUCAUCCAGACAGACA 3′);

Lxxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 73 (5′ UGUGUAGAUGGUCUUGUCUGUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 238 (5′ CAGACAAGACCAUCUACACA 3′);

Lxxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 100 (5′ UGAGGUCAAAGGGCAUUCCUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 265 (5′ AGGAAUGCCCUUUGACCUCA 3′);

Lxxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 205 (5′ UAUGAUGAGGGUGUUCCUAUCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 370 (5′ AUAGGAACACCCUCAUCAUA 3′);

Lxxx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 119 (5′ UAUGUAGUUGCAGCAGUCCAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 284 (5′ UGGACUGCUGCAACUACAUA 3′);

Lxxxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 82 (5′ UUUCAUAGUAGGCUCGGAUCUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 247 (5′ GAUCCGAGCCUACUAUGAAA 3′);

Lxxxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 79 (5′ UGUUGACGAGUUCCGGAAUGUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 244 (5′ CAUUCCGGAACUCGUCAACA 3′);

Lxxxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 171 (5′ UAGUAUCUCUGUUCAUUGAGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 336 (5′ CUCAAUGAACAGAGAUACUA 3′);

Lxxxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 182 (5′ UUUUUCCUUCAGCUGUGACUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 347 (5′ AGUCACAGCUGAAGGAAAAA 3′);

Lxxxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 153 (5′ UUGAAGGCCAGCUGCUGGGUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 318 (5′ ACCCAGCAGCUGGCCUUCAA 3′);

Lxxxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 186 (5′ UUUUAUGGUGACCUUGAGGUCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 351 (5′ ACCUCAAGGUCACCAUAAAA 3′);

Lxxxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 191 (5′ UAUCAUAGUGUUCUUGGCAUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 356 (5′ AUGCCAAGAACACUAUGAUA 3′);

Lxxxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 141 (5′ UCUGCAGAAGGCUGGAUUGUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 306 (5′ ACAAUCCAGCCUUCUGCAGA 3′);

Lxxxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 144 (5′ UGUUUUGUUCAUUCUGAUUCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 309 (5′ GAAUCAGAAUGAACAAAACA 3′);

XC) an antisense strand of nucleic acid sequence according to SEQ ID NO: 200 (5′ UUUUGUCCAGCUCAUACUUGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 365 (5′ CAAGUAUGAGCUGGACAAAA 3′);

XCi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 89 (5′ UCUAUGACCUCGAAACUGGGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 254 (5′ CCCAGUUUCGAGGUCAUAGA 3′);

XCii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 120 (5′ UGUGAUGUAGUUGCAGCAGUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 285 (5′ ACUGCUGCAACUACAUCACA 3′);

XCiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 86 (5′ UUACUCCUUCACCUCAAACUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 251 (5′ AGUUUGAGGUGAAGGAGUAA 3′);

XCiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 166 (5′ UUCUUUUAGCUGCAGUAGGGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 331 (5′ CCCUACUGCAGCUAAAAGAA 3′);

XCv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 101 (5′ UAACACCAUGAGGUCAAAGGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 266 (5′ CCUUUGACCUCAUGGUGUUA 3′);

XCvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 161 (5′ UUGUAGGUUCAUGUAGUUGGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 326 (5′ CCAACUACAUGAACCUACAA 3′);

XCvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 175 (5′ UCAGAUUCCCAGUGGAUACGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 340 (5′ CGUAUCCACUGGGAAUCUGA 3′);

XCviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 149 (5′ UUUCAUCCAGGUAAUGCACAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 314 (5′ UGUGCAUUACCUGGAUGAAA 3′);

XCix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 214 (5′ UGGUUGUAAUAGGCGUAGACCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 379 (5′ GUCUACGCCUAUUACAACCA 3′); or

C) an antisense strand of nucleic acid sequence according to SEQ ID NO: 62 (5′ UGACAGUGCAGGGUCAGAGGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 227 (5′ CCUCUGACCCUGCACUGUCA 3′).

45 . (canceled)

46 . The isolated oligonucleotide of claim 38 , wherein the double stranded region comprises:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 94 (5′ UUAGAUGUAGUAGAAUUUCUCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 259 (5′ AGAAAUUCUACUACAUCUAA 3′); or

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 216 (5′ UGAAGCAAUUCUCCUCAGCACA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 381 (5′ UGCUGAGGAGAAUUGCUUCA 3′).

47 .- 50 . (canceled)

51 . The isolated oligonucleotide of claim 1 , wherein the antisense strand comprises nucleotides modified with 2′-F modification, and nucleotides modified with 2′-O-methyl modification, according to the formula:

3′(M) 0 (F) 0 (M) 6 (F) 1 (M) 1 (F) 1 (M) 3 (F) 1 (M) 2 (F) 1 (M) 1 (F) 1 (M) 1 (F) 2 (M) 1 5′.

52 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises nucleotides modified with 2′-F modification, and nucleotides modified with 2′-O-methyl modification, according to the formula:

5′(M) 0 (F) 0 (M) 5 (F) 1 (M) 1 (F) 4 (M) 9 3′.

53 . The isolated oligonucleotide of claim 1 , wherein the antisense strand comprises any one of:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 451 (5′ [mUs][fUs][fA][mG][fU][mA][fG][mA][mA][fU][mU][mU][mC][fU][mC][fU][mG][mU][mA][mGs][mGs][mC] 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 452 (5′ [mUs][fGs][fU][mA][fG][mU][fA][mG][mA][fA][mU][mU][mU][fC][mU][fC][mU][mG][mU][mAs][mGs][mG] 3′);

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 453 (5′ [mUs][fAs][fU][mG][fU][mA][fG][mU][mA][fG][mA][mA][mU][fU][mU][fC][mU][mC][mU][mGs][mUs][mA] 3′),

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 454 (5′ [mUs][fAs][fU][mA][fG][mA][fU][mG][mU][fA][mG][mU][mA][fG][mA][fA][mU][mU][mU][mCs][mUs][mC] 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 455 (5′ [mUs][fAs][fU][mG][fA][mA][fG][mC][mA][fA][mU][mU][mC][fJ][mC][fC][mU][mC][mA][mGs][mCs][mA] 3′);

vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 456 (5′ [mUs][fUs][fU][mU][fG][mU][fA][mU][mG][fA][mA][mG][mC][fA][mA][fU][mU][mC][mU][mCs][mCs][mU] 3′),

vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 457 (5′ [MeEPmUs][fJs][fA][mG][fU][mA][fG][mA][mA][fU][mU][mU][mC][fU][mC][fU][mG][mU][mA][mGs][mGs][mC] 3′);

viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 458 (5′ [MeEPmUs][fGs][fU][mA][fG][mU][fA][mG][mA][fA][mU][mU][mU][fC][mU][fC][mU][mG][mU][mAs][mGs][mG] 3′); or

ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 459 (5′ [MeEPmUs][fAs][fU][mG][fU][mA][fG][mU][mA][fG][mA][mA][mU][fU][mU][fC][mU][mC][mU][mGs][mUs][mA] 3′),

wherein “m” is a 2′-O-methyl modified nucleotide, “f” is a 2′-F modified nucleotide, “s” is a phosphorothioate internucleotide linkage, “MeEP” is a mono methyl protected phosphate mimic.

54 . The isolated oligonucleotide of claim 1 ,

wherein the sense strand comprises any one of:

i) a sense strand of nucleic acid sequence according to SEQ ID NO: 444 (5′ [mCs][mUs][mA][mC][mA][fG][mA][fG][fA][fA][fA][mU][mU][mC][mU][mA][mC][mUs][mAs][mA][G1b][G1b][G1b] 3′);

ii) a sense strand of nucleic acid sequence according to SEQ ID NO: 445 (5′ [mUs][mAs][mC][mA][mG][fA][mG][fA][fA][fA][fU][mU][mC][mU][mA][mC][mU][mAs][mCs][mA][G1b][G1b][G1b] 3′);

iii) a sense strand of nucleic acid sequence according to SEQ ID NO: 446 (5′ [mCs][mAs][mG][mA][mG][fA][mA][fA][fU][fU][fC][mU][mA][mC][mU][mA][mC][mAs][mUs][mA][G1b][G1b][G1b] 3′),

iv) a sense strand of nucleic acid sequence according to SEQ ID NO: 447 (5′ [mGs][mAs][mA][mA][mU][fU][mC][fU][fA][fC][fU][mA][mC][mA][mU][mC][mU][mAs][mUs][mA][G1b][G1b][G1b] 3′);

v) a sense strand of nucleic acid sequence according to SEQ ID NO: 448 (5′ [mCs][mUs][mG][mA][mG][fG][mA][fG][fA][fA][fU][mU][mG][mC][mU][mU][mC][mAs][mUs][mA][G1b][G1b][G1b] 3′); or

vi) a sense strand of nucleic acid sequence according to SEQ ID NO: 449 (5′ [mGs][mAs][mG][mA][mA][fU][mU][fG][fC][fU][fU][mC][mA][mU][mA][mC][mA][mAs][mAs][mA][G1b][G1b][G1b] 3′),

wherein “m” is a 2′-O-methyl modified nucleotide, “f” is a 2′-F modified nucleotide, “s” is a phosphorothioate internucleotide linkage, and “G1b” is a GalNac G1b moiety.

55 . The isolated oligonucleotide of claim 1 , wherein the double stranded region comprises:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 451 (5′ [mUs][fUs][fA][mG][fU][mA][fG][mA][mA][fU][mU][mU][mC][fU][mC][fU][mG][mU][mA][mGs][mGs][mC] 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 444 (5′ [mCs][mUs][mA][mC][mA][fG][mA][fG][fA][fA][fA][mU][mU][mC][mU][mA][mC][mUs][mAs][mA][G1b][G1b][G1b] 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 453 (5′ [mUs][fAs][fU][mG][fU][mA][fG][mU][mA][fG][mA][mA][mU][fU][mU][fC][mU][mC][mU][mGs][mUs][mA] 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 446 (5′ [mCs][mAs][mG][mA][mG][fA][mA][fA][fU][fU][fC][mU][mA][mC][mU][mA][mC][mAs][mUs][mA][G1b][G1b][G1b] 3′);

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 457 (5′ [MeEPmUs][fJs][fA][mG][fU][mA][fG][mA][mA][fU][mU][mU][mC][fU][mC][fU][mG][mU][mA][mGs][mGs][mC] 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 444 (5′ [mCs][mUs][mA][mC][mA][fG][mA][fG][fA][fA][fA][mU][mU][mC][mU][mA][mC][mUs][mAs][mA][G1b][G1b][G1b] 3′); or

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 459 (5′ [MeEPmUs][fAs][fU][mG][fU][mA][fG][mU][mA][fG][mA][mA][mU][fU][mU][fC][mU][mC][mU][mGs][mUs][mA] 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 446 (5′ [mCs][mAs][mG][mA][mG][fA][mA][fA][fU][fU][fC][mU][mA][mC][mU][mA][mC][mAs][mUs][mA][G1b][G1b][G1b] 3′).

56 . A vector encoding the isolated oligonucleotide of claim 1 .

57 . (canceled)

58 . A pharmaceutical composition comprising at least one isolated oligonucleotide of any one of claim 1 , and a pharmaceutically acceptable carrier, diluent or excipient.

59 .- 60 . (canceled)

61 . A method of inhibiting or downregulating the expression or level of C3 or treating or preventing a disease or disorder associated with aberrant or increased expression or activity of C3 or a disease or disorder where C3 plays a role in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of at least one isolated oligonucleotide of claim 1 .

Assignments (2)
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Dec 18, 2025
From: SANEGENE BIO INC.
To: SANEGENE BIO USA INC.
Reel/Frame 073966/0761 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Nov 1, 2023
From: ZHANG, CHUNYANG; GENG, XIN; WANG, SHIYU; WANG, WEIMIN
To: SANEGENE BIO USA INC.
Reel/Frame 065424/0165 →