IP Library › Patent Application 18585697

Patent Application

App. No. 18/585,697

SMALL INTERFERING RNA TARGETING HBV AND USES THEREOF

Loading inventors, assignments & file history…

Monitor This Case

Get email alerts when status or documents change.

Order Certified Copies

Most orders are placed with the USPTO same day — all within 24 business hours.

Order via The Patent Place →

Pre-filled with this patent's details

Quick Facts

Patent No.: US None
App. No.: 18/585,697

External Links

USPTO Patent Center↗ Full Patent PDF↗

Abstract

This disclosure relates to isolated oligonucleotides comprising duplex regions targeting hepatitis B virus (HBV) mRNA, and delivery systems, kits and compositions comprising the same, and methods of using the same for inhibiting or downregulating HBV gene and surface antigen expression.

Claims (245)

1 . An isolated oligonucleotide comprising a sense strand and an antisense strand, wherein:

the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising 19-25 nucleotides between any one of the nucleotide positions selected from:

a) 158 to 240;

b) 389 to 439;

c) 558 to 578; and

d) 621 to 823,

from the 5′ end of a hepatitis B virus (HBV) mRNA sequence according to SEQ ID NO: 1,

and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double stranded region.

2 .- 3 . (canceled)

4 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a nucleotide sequence that is substantially identical to a region between any one of the nucleotide positions selected from:

a) 158 to 240;

b) 389 to 439;

c) 621 to 686; and

d) 775 to 823,

from the 5′ end of a hepatitis B virus (HBV) mRNA sequence according to SEQ ID NO: 1.

5 .- 6 . (canceled)

7 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a nucleotide sequence that is substantially identical to a region between any one of the nucleotide positions selected from:

a) 206 to 226;

b) 558 to 578; and

c) 720 to 807,

from the 5′ end of a hepatitis B virus (HBV) mRNA sequence according to SEQ ID NO: 1.

8 .- 17 . (canceled)

18 . The isolated oligonucleotide of claim 1 , wherein the antisense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 2-26, 52-68, and 86-158.

19 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 27-51, 69-85, and 159-231.

20 . The isolated oligonucleotide of claim 4 , wherein the double stranded region comprises:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 2 (5′ UAUCCUGAUGUGAUGUUCUCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 27 (5′ GAGAACAUCACAUCAGGAUA 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 3 (5′ UUAGGAAUCCUGAUGUGAUGUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 28 (5′ CAUCACAUCAGGAUUCCUAA 3′);

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 4 (5′ UUGUAACACGAGAAGGGGUCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 29 (5′ GACCCCUUCUCGUGUUACAA 3′);

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 5 (5′ UUCAACAAGAAAAACCCCGCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 30 (5′ GCGGGGUUUUUCUUGUUGAA 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 6 (5′ UUAUUGUGAGGAUUCUUGUCAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 31 (5′ GACAAGAAUCCUCACAAUAA 3′);

vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 7 (5′ UAGAGGAAGAUGAUAAAACGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 32 (5′ CGUUUUAUCAUCUUCCUCUA 3′);

vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 8 (5′ UAUAGCAGCAGGAUGAAGAGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 33 (5′ CUCUUCAUCCUGCUGCUAUA 3′);

viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 9 (5′ UAGAAGAUGAGGCAUAGCAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 34 (5′ CUGCUAUGCCUCAUCUUCUA 3′);

ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 10 (5′ UACAAGAAGAUGAGGCAUAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 35 (5′ CUAUGCCUCAUCUUCUUGUA 3′);

x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 11 (5′ UAGGAAUUUUCCGAAAGCCCAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 36 (5′ GGGCUUUCGGAAAAUUCCUA 3′);

xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 12 (5′ UUAGGAAUUUUCCGAAAGCCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 37 (5′ GGCUUUCGGAAAAUUCCUAA 3′);

xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 13 (5′ UACUAGUAAACUGAGCCAGGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 38(5′ CCUGGCUCAGUUUACUAGUA 3′);

xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 14 (5′ UUAAAAAGGGACUCAAGAUGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 39 (5′ CAUCUUGAGUCCCUUUUUAA 3′);

xiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 15 (5′ UAGAAAAUUGGUAACAGCGGUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 40 (5′ CCGCUGUUACCAAUUUUCUA 3′);

xv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 16 (5′ UAAGAAAAUUGGUAACAGCGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 41 (5′ CGCUGUUACCAAUUUUCUUA 3′);

xvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 17 (5′ UAAAGAAAAUUGGUAACAGCGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 42 (5′ GCUGUUACCAAUUUUCUUUA 3′);

xvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 18 (5′ UAAAAGAAAAUUGGUAACAGCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 43 (5′ CUGUUACCAAUUUUCUUUUA 3′);

xviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 19 (5′ UACAAAAGAAAAUUGGUAACAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 44 (5′ GUUACCAAUUUUCUUUUGUA 3′); or

xix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 20 (5′ UAAAGACAAAAGAAAAUUGGUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 45 (5′ CCAAUUUUCUUUUGUCUUUA 3′).

21 . The isolated oligonucleotide of claim 7 , wherein the double stranded region comprises:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 21 (5′ UUUGUCAACAAGAAAAACCCCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 46 (5′ GGGUUUUUCUUGUUGACAAA 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 22 (5′ UUUGGUACAGCAACAGGAGGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 47 (5′ CCUCCUGUUGCUGUACCAAA 3′);

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 23 (5′ UAUAACUGAAAGCCAAACAGUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 48 (5′ CUGUUUGGCUUUCAGUUAUA 3′);

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 24 (5′ UACCACAUCAUCCAUAUAACUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 49 (5′ GUUAUAUGGAUGAUGUGGUA 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 25 (5′ UAAAAAGGGACUCAAGAUGCUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 50 (5′ GCAUCUUGAGUCCCUUUUUA 3′); or

vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 26 (5′ UUGGUAACAGCGGUAAAAAGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 51 (5′ CUUUUUACCGCUGUUACCAA 3′).

22 . (canceled)

23 . The isolated oligonucleotide of claim 221 , wherein the double stranded region comprises:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 4 (5′ UUGUAACACGAGAAGGGGUCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 29 (5′ GACCCCUUCUCGUGUUACAA 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 5 (5′ UUCAACAAGAAAAACCCCGCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 30 (5′ GCGGGGUUUUUCUUGUUGAA 3′);

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 14 (5′ UUAAAAAGGGACUCAAGAUGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 39 (5′ CAUCUUGAGUCCCUUUUUAA 3′);

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 8 (5′ UAUAGCAGCAGGAUGAAGAGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 33 (5′ CUCUUCAUCCUGCUGCUAUA 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 21 (5′ UUUGUCAACAAGAAAAACCCCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 46 (5′ GGGUUUUUCUUGUUGACAAA 3′);

vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 6 (5′ UUAUUGUGAGGAUUCUUGUCAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 31 (5′ GACAAGAAUCCUCACAAUAA 3′);

vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 7 (5′ UAGAGGAAGAUGAUAAAACGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 32 (5′ CGUUUUAUCAUCUUCCUCUA 3′);

viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 15 (5′ UAGAAAAUUGGUAACAGCGGUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 40 (5′ CCGCUGUUACCAAUUUUCUA 3′);

ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 2 (5′ UAUCCUGAUGUGAUGUUCUCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 27 (5′ GAGAACAUCACAUCAGGAUA 3′);

x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 16 (5′ UAAGAAAAUUGGUAACAGCGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 41 (5′ CGCUGUUACCAAUUUUCUUA 3′);

xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 17 (5′ UAAAGAAAAUUGGUAACAGCGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 42 (5′ GCUGUUACCAAUUUUCUUUA 3′);

xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 22 (5′ UUUGGUACAGCAACAGGAGGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 47 (5′ CCUCCUGUUGCUGUACCAAA 3′);

xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 24 (5′ UACCACAUCAUCCAUAUAACUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 49 (5′ GUUAUAUGGAUGAUGUGGUA 3′);

xiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 26 (5′ UUGGUAACAGCGGUAAAAAGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 51 (5′ CUUUUUACCGCUGUUACCAA 3′); xv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 21 (5′ UUUGUCAACAAGAAAAACCCCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 46 (5′ GGGUUUUUCUUGUUGACAAA 3′), or

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 12 (5′ UUAGGAAUUUUCCGAAAGCCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 37 (5′ GGCUUUCGGAAAAUUCCUAA 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 3 (5′ UUAGGAAUCCUGAUGUGAUGUU 3′), and a sense strand of nucleic acid according to SEQ ID NO: 28 (5′ CAUCACAUCAGGAUUCCUAA 3′);

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 10 (5′ UACAAGAAGAUGAGGCAUAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 35 (5′ CUAUGCCUCAUCUUCUUGUA 3′);

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 19 (5′ UACAAAAGAAAAUUGGUAACAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 44 (5′ GUUACCAAUUUUCUUUUGUA 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 9 (5′ UAGAAGAUGAGGCAUAGCAGCA 3′), and a sense strand of nucleic acid according to SEQ ID NO: 34 (5′ CUGCUAUGCCUCAUCUUCUA 3′);

vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 13 (5′ UACUAGUAAACUGAGCCAGGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 38(5′ CCUGGCUCAGUUUACUAGUA 3′);

vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 20 (5′ UAAAGACAAAAGAAAAUUGGUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 45 (5′ CCAAUUUUCUUUUGUCUUUA 3′);

viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 11 (5′ UAGGAAUUUUCCGAAAGCCCAG 3′), and a sense strand of nucleic acid according to SEQ ID NO: 36 (5′ GGGCUUUCGGAAAAUUCCUA 3′);

ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 18 (5′ UAAAAGAAAAUUGGUAACAGCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 43 (5′ CUGUUACCAAUUUUCUUUUA 3′); or

x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 23 (5′ UAUAACUGAAAGCCAAACAGUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 48 (5′ CUGUUUGGCUUUCAGUUAUA 3′) or

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 12 (5′ UUAGGAAUUUUCCGAAAGCCCA 3′), and a sense strand of nucleic acid according to SEQ ID NO: 37 (5′ GGCUUUCGGAAAAUUCCUAA 3′);

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 19 (5′ UACAAAAGAAAAUUGGUAACAG 3′), and a sense strand of nucleic acid according to SEQ ID NO: 44 (5′ GUUACCAAUUUUCUUUUGUA 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 9 (5′ UAGAAGAUGAGGCAUAGCAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 34 (5′ CUGCUAUGCCUCAUCUUCUA 3′);

viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 11 (5′ UAGGAAUUUUCCGAAAGCCCAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 36 (5′ GGGCUUUCGGAAAAUUCCUA 3′);

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 17 (5′ UAAAGAAAAUUGGUAACAGCGG 3′), and a sense strand of nucleic acid according to SEQ ID NO: 42 (5′ GCUGUUACCAAUUUUCUUUA 3′);

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 24 (5′ UACCACAUCAUCCAUAUAACUG 3′), and a sense strand of nucleic acid sequence according to SEO ID NO: 49 (5′ GUUAUAUGGAUGAUGUGGUA 3′);

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 10 (5′ UACAAGAAGAUGAGGCAUAGCA 3′), and a sense strand of nucleic acid according to SEQ ID NO: 35 (5′ CUAUGCCUCAUCUUCUUGUA 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 12 (5′ UUAGGAAUUUUCCGAAAGCCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 37 (5′ GGCUUUCGGAAAAUUCCUAA 3′);

vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 19 (5′ UACAAAAGAAAAUUGGUAACAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 44 (5′ GUUACCAAUUUUCUUUUGUA 3′);

ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 13 (5′ UACUAGUAAACUGAGCCAGGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 38 (5′ CCUGGCUCAGUUUACUAGUA 3′);

xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 18 (5′ UAAAAGAAAAUUGGUAACAGCG 3′), and a sense strand of nucleic acid according to SEQ ID NO: 43 (5′ CUGUUACCAAUUUUCUUUUA 3′); or

xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 23 (5′ UAUAACUGAAAGCCAAACAGUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 48 (5′ CUGUUUGGCUUUCAGUUAUA 3′).

24 .- 27 . (canceled)

28 . An isolated oligonucleotide comprising a sense strand and an antisense strand, wherein:

the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising 19-25 nucleotides between any one of the nucleotide positions selected from:

a) 157 to 177;

b) 196 to 410;

c) 578 to 598; and

d) 762 to 782,

from the 5′ end of a hepatitis B virus (HBV) mRNA sequence according to SEQ ID NO: 1,

and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double stranded region.

29 . (canceled)

30 . The isolated oligonucleotide of claim 28 , wherein the double stranded region comprises:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 57 (5′ UACUGAGAGAAGUCCACCACGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 74 (5′ GUGGUGGACUUCUCUCAGUA 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 66 (5′ UAAGAGGAAGAUGAUAAAACGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 83 (5′ GUUUUAUCAUCUUCCUCUUA 3′);

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 56 (5′ UCUGAGAGAAGUCCACCACGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 73 (5′ CGUGGUGGACUUCUCUCAGA 3′);

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 63 (5′ UUUUUGGCCAAGACACACGGUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 80 (5′ CCGUGUGUCUUGGCCAAAAA 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 65 (5′ UAGGACAAGUUGGAGGACAGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 82 (5′ CUGUCCUCCAACUUGUCCUA 3′);

vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 68 (5′ UAAGAUGCUGUACAGACUUGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 85 (5′ CAAGUCUGUACAGCAUCUUA 3′);

vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 52 (5′ UUCCUGAUGUGAUGUUCUCCAU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 69 (5′ GGAGAACAUCACAUCAGGAA 3′);

viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 59 (5′ UUUGAGAGAAGUCCACCACGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 76 (5′ CGUGGUGGACUUCUCUCAAA 3′);

ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 55 (5′ UUGUCAACAAGAAAAACCCCGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 72 (5′ GGGGUUUUUCUUGUUGACAA 3′);

x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 54 (5′ UUAUUGUGAGGAUUUUUGUCGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 71 (5′ GACAAAAAUCCUCACAAUAA 3′);

xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 67 (5′ UUGCAAUUUCCGUCCGAAGGUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 84 (5′ CCUUCGGACGGAAAUUGCAA 3′);

xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 53 (5′ UUUGUGAGGAUUUUUGUCAAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 70 (5′ UUGACAAAAAUCCUCACAAA 3′), or

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 53 (5′ UUUGUGAGGAUUUUUGUCAAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 70 (5′ UUGACAAAAAUCCUCACAAA 3′); or

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 67 (5′ UUGCAAUUUCCGUCCGAAGGUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 84 (5′ CCUUCGGACGGAAAUUGCAA 3′.

31 .- 32 . (canceled)

33 . An isolated oligonucleotide comprising a sense strand and an antisense strand, wherein:

the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising 19-25 nucleotides between any one of the nucleotide positions selected from:

a) 158 to 276;

b) 389 to 578; and

c) 666 to 823,

from the 5′ end of a hepatitis B virus (HBV) mRNA sequence according to SEQ ID NO: 1,

and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double stranded region.

34 . (canceled)

35 . The isolated oligonucleotide of claim 33 , wherein the double stranded region comprises:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 17 (5′ UAAAGAAAAUUGGUAACAGCGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 42 (5′ GCUGUUACCAAUUUUCUUUA 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 19 (5′ UACAAAAGAAAAUUGGUAACAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 44 (5′ GUUACCAAUUUUCUUUUGUA 3′);

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 15 (5′ UAGAAAAUUGGUAACAGCGGUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 40 (5′ CCGCUGUUACCAAUUUUCUA 3′);

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 18 (5′ UAAAAGAAAAUUGGUAACAGCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 43 (5′ CUGUUACCAAUUUUCUUUUA 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 20 (5′ UAAAGACAAAAGAAAAUUGGUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 45 (5′ CCAAUUUUCUUUUGUCUUUA 3′);

vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 16 (5′ UAAGAAAAUUGGUAACAGCGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 41 (5′ CGCUGUUACCAAUUUUCUUA 3′);

vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 54 (5′ UUAUUGUGAGGAUUUUUGUCGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 71 (5′ GACAAAAAUCCUCACAAUAA 3′);

viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 56 (5′ UCUGAGAGAAGUCCACCACGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 73 (5′ CGUGGUGGACUUCUCUCAGA 3′);

ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 26 (5′ UUGGUAACAGCGGUAAAAAGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 51 (5′ CUUUUUACCGCUGUUACCAA 3′);

x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 21 (5′ UUUGUCAACAAGAAAAACCCCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 46 (5′ GGGUUUUUCUUGUUGACAAA 3′);

xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 6 (5′ UUAUUGUGAGGAUUCUUGUCAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 31 (5′ GACAAGAAUCCUCACAAUAA 3′);

xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 13 (5′ UACUAGUAAACUGAGCCAGGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 38(5′ CCUGGCUCAGUUUACUAGUA 3′);

xiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 10 (5′ UACAAGAAGAUGAGGCAUAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 35 (5′ CUAUGCCUCAUCUUCUUGUA 3′);

xv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 2 (5′ UAUCCUGAUGUGAUGUUCUCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 27 (5′ GAGAACAUCACAUCAGGAUA 3′);

xvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 7 (5′ UAGAGGAAGAUGAUAAAACGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 32 (5′ CGUUUUAUCAUCUUCCUCUA 3′);

xvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 14 (5′ UUAAAAAGGGACUCAAGAUGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 39 (5′ CAUCUUGAGUCCCUUUUUAA 3′);

xviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 8 (5′ UAUAGCAGCAGGAUGAAGAGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 33 (5′ CUCUUCAUCCUGCUGCUAUA 3′);

xix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 57 (5′ UACUGAGAGAAGUCCACCACGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 74 (5′ GUGGUGGACUUCUCUCAGUA 3′);

xx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 4 (5′ UUGUAACACGAGAAGGGGUCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 29 (5′ GACCCCUUCUCGUGUUACAA 3′);

xxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 3 (5′ UUAGGAAUCCUGAUGUGAUGUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 28 (5′ CAUCACAUCAGGAUUCCUAA 3′);

xxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 25 (5′ UAAAAAGGGACUCAAGAUGCUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 50 (5′ GCAUCUUGAGUCCCUUUUUA 3′);

xxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 5 (5′ UUCAACAAGAAAAACCCCGCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 30 (5′ GCGGGGUUUUUCUUGUUGAA 3′), or

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 18 (5′ UAAAAGAAAAUUGGUAACAGCG 3′), and a sense strand of nucleic acid according to SEQ ID NO: 43 (5′ CUGUUACCAAUUUUCUUUUA 3′);

x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 21 (5′ UUUGUCAACAAGAAAAACCCCG 3′), and a sense strand of nucleic acid sequence according to SEO ID NO: 46 (5′ GGGUUUUUCUUGUUGACAAA 3′);

xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 6 (5′ UUAUUGUGAGGAUUCUUGUCAA 3′), and a sense strand of nucleic acid according to SEQ ID NO: 31 (5′ GACAAGAAUCCUCACAAUAA 3′);

xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 23 (5′ UAUAACUGAAAGCCAAACAGUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 48 (5′ CUGUUUGGCUUUCAGUUAUA 3′);

xiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 10 (5′ UACAAGAAGAUGAGGCAUAGCA 3′), and a sense strand of nucleic acid according to SEQ ID NO: 35 (5′ CUAUGCCUCAUCUUCUUGUA 3′);

xv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 24 (5′ UACCACAUCAUCCAUAUAACUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 49 (5′ GUUAUAUGGAUGAUGUGGUA 3′);

xvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 126 (5′ UUACAUAGAGGUUCCUUGAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 199 (5′ CUCAAGGAACCUCUAUGUAA 3′);

xviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 89 (5′ UUAGACUCUGCGGUAUUGUGAG 3′), and a sense strand of nucleic acid according to SEQ ID NO: 162 (5′ CACAAUACCGCAGAGUCUAA 3′);

xx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 92 (5′ UAUUGAGAGAAGUCCACCACGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 165 (5′ GUGGUGGACUUCUCUCAAUA 3′);

xxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 3 (5′ UUAGGAAUCCUGAUGUGAUGUU 3′), and a sense strand of nucleic acid according to SEQ ID NO: 28 (5′ CAUCACAUCAGGAUUCCUAA 3′);

xxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 5 (5′ UUCAACAAGAAAAACCCCGCCU 3′), and a sense strand of nucleic acid sequence according to SEO ID NO: 30 (5′ GCGGGGUUUUUCUUGUUGAA 3′);

xxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 22 (5′ UUUGGUACAGCAACAGGAGGGA 3′), and a sense strand of nucleic acid according to SEQ ID NO: 47 (5′ CCUCCUGUUGCUGUACCAAA 3′);

xxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 119 (5′ UUUGAGGAUCCUGGAAUUAGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 192 (5′ CUAAUUCCAGGAUCCUCAAA 3′);

xxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 58 (5′ UAAAACUGAGAGAAGUCCACGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 75 (5′ GUGGACUUCUCUCAGUUUUA 3′); or

xxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 90 (5′ UUCUAGACUCUGCGGUAUUGUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 163 (5′ CAAUACCGCAGAGUCUAGAA 3′).

36 .- 41 . (canceled)

42 . The isolated oligonucleotide of claim 1 , wherein the antisense strand comprises nucleotides modified with 2′-F modification, and nucleotides modified with 2′-O-methyl modification, according to the formula:

3′( M ) 0 ( F ) 0 ( M ) 6 ( F ) 1 ( M ) 1 ( F ) 1 ( M ) 3 ( F ) 1 ( M ) 2 ( F ) 1 ( M ) 1 ( F ) 1 ( M ) 1 ( F ) 2 ( M ) 1 5′.

43 . The isolated oligonucleotide of claim 1 ,

wherein the sense strand comprises nucleotides modified with 2′-F modification, and nucleotides modified with 2′-O-methyl modification, according to the formula:

5′( M ) 0 ( F ) 0 ( M ) 5 ( F ) 1 ( M ) 1 ( F ) 4 ( M ) 9 3′.

44 . The isolated oligonucleotide of claim 42 , wherein the antisense strand comprises any one of:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 232 (5′ [mUs][fAs][fU][mC][fC][mU][fG][mA][mU][fG][mU][mG][mA][fU][mG][fU][mU][mC][mU][mCs][mCs][mA] 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 233 (5′ [mUs][fUs][fA][mG][fG][mA][fA][mU][mC][fC][mU][mG][mA][fU][mG][fU][mG][mA][mU][mGs][mUs][mU] 3′);

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 234 (5′ [mUs][fUs][fC][mA][fA][mC][fA][mA][mG][fA][mA][mA][mA][fA][mC][fC][mC][mC][mG][mCs][mCs][mU] 3′);

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 235 (5′ [mUs][fUs][fU][mG][fU][mC][fA][mA][mC][fA][mA][mG][mA][fA][mA][fA][mA][mC][mC][mCs][mCs][mG] 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID: 236 (5′ [mUs][fUs][fA][mU][fU][mG][fU][mG][mA][fG][mG][mA][mU][fU][mC][fU][mU][mG][mU][mCs][mAs][mA] 3′);

vi) an antisense strand of nucleic acid sequence according to SEQ ID: 237 (5′ [mUs][fUs][fA][mG][fG][mA][fA][mU][mU][fU][mU][mC][mC][fG][mA][fA][mA][mG][mC][mCs][mCs][mA] 3′);

vii) an antisense strand of nucleic acid sequence according to SEQ ID: 238 (5′ [mUs][fAs][fU][mA][fA][mC][fU][mG][mA][fA][mA][mG][mC][fC][mA][fA][mA][mC][mA][mGs][mUs][mG] 3′);

viii) an antisense strand of nucleic acid sequence according to SEQ ID: 239 (5′ [mUs][fAs][fG][mA][fA][mA][fA][mU][mU][fG][mG][mU][mA][fA][mC][fA][mG][mC][mG][mGs][mUs][mA] 3′);

ix) an antisense strand of nucleic acid sequence according to SEQ ID: 240 (5′ [mUs][fAs][fA][mA][fA][mG][fA][mA][mA][fA][mU][mU][mG][fG][mU][fA][mA][mC][mA][mGs][mCs][mG] 3′); or

x) an antisense strand of nucleic acid sequence according to SEQ ID: 241 (5′ [mUs][fAs][fC][mA][fA][mA][fA][mG][mA][fA][mA][mA][mU][fU][mG][fG][mU][mA][mA][mCs][mAs][mG] 3′), wherein “m” is a 2′-O-methyl modified nucleotide, “f” is a 2′-F modified nucleotide, “s” is a phosphorothioate internucleotide linkage.

45 . The isolated oligonucleotide of claim 43 , wherein the sense strand comprises any one of:

i) a sense strand of nucleic acid sequence according to SEQ ID NO: 242 (5′ [mGs][mAs][mG][mA][mA][fC][mA][fU][fC][fA][fC][mA][mU][mC][mA][mG][mG][mAs][m Us][mA][G1b][G1b][G1b] 3′);

ii) a sense strand of nucleic acid sequence according to SEQ ID NO: 243 (5′ [mCs][mAs][mU][mC][mA][fC][mA][fU][fC][fA][fG][mG][mA][mU][mU][mC][mC][mUs][m As][mA][G1b][G1b][G1b] 3′);

iii) a sense strand of nucleic acid sequence according to SEQ ID NO: 244 (5′ [mGs][mCs][mG][mG][mG][fG][mU][fU][fU][fU][fU][mC][mU][mU][mG][mU][mU][mGs][m As][mA][G1b][G1b][G1b] 3′);

iv) a sense strand of nucleic acid sequence according to SEQ ID NO: 245 (5′ [mGs][mGs][mG][mU][mU][fU][mU][fU][fC][fU][fU][mG][mU][mU][mG][mA][mC][mAs][m As][mA][G1b][G1b][G1b] 3′);

v) a sense strand of nucleic acid sequence according to SEQ ID NO: 246 (5′ [mGs][mAs][mC][mA][mA][fG][mA][fA][fU][fC][fC][mU][mC][mA][mC][mA][mA][mUs][m As][mA][G1b][G1b][G1b] 3′);

vi) a sense strand of nucleic acid sequence according to SEQ ID NO: 247 (5′ [mGs][mGs][mC][mU][mU][fU][mC][fG][fG][fA][fA][mA][mA][mU][mU][mC][mC][mUs][m As][mA][G1b][G1b][G1b] 3′);

vii) a sense strand of nucleic acid sequence according to SEQ ID NO: 248 (5′ [mCs][mUs][mG][mU][mU][fU][mG][fG][fC][fU][fU][mU][mC][mA][mG][mU][mU][mAs][m Us][mA][G1b][G1b][G1b] 3);

viii) a sense strand of nucleic acid sequence according to SEQ ID NO: 249 (5′ [mCs][mCs][mG][mC][mU][fG][mU][fU][fA][fC][fC][mA][mA][mU][mU][mU][mU][mCs][m Us][mA][G1b][G1b][G1b] 3′);

ix) a sense strand of nucleic acid sequence according to SEQ ID NO: 250 (5′ [mCs][mUs][mG][mU][mU][fA][mC][fC][fA][fA][fU][mU][mU][mU][mC][mU][mU][mUs][m Us][mA][G1b][G1b][G1b] 3′); or

x) a sense strand of nucleic acid sequence according to SEQ ID NO: 251 (5′ [mGs][mUs][mU][mA][mC][fC][mA][fA][fU][fU][fU][mU][mC][mU][mU][mU][mU][mGs][m Us][mA][G1b][G1b][G1b] 3′), wherein “m” is a 2′-O-methyl modified nucleotide, “f” is a 2′-F modified nucleotide, “s” is a phosphorothioate internucleotide linkage, and “G1b” is a GalNac G1b moiety.

46 . The isolated oligonucleotide of claim of claim 44 , wherein the double stranded region comprises:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 232 (5′ [mUs][fAs][fU][mC][fC][mU][fG][mA][mU][fG][mU][mG][mA][fU][mG][fU][mU][mC][mU][mCs][mCs][mA] 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 242 (5′ [mGs][mAs][mG][mA][mA][fC][mA][fU][fC][fA][fC][mA][mU][mC][mA][mG][mG][mAs][m Us][mA][G1b][G1b][G1b] 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: SEQ ID: 233 (5′ [mUs][fUs][fA][mG][fG][mA][fA][mU][mC][fC][mU][mG][mA][fU][mG][fU][mG][mA][mU][mGs][mUs][mU] 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: NO: 243 (5′ [mCs][mAs][mU][mC][mA][fC][mA][fU][fC][fA][fG][mG][mA][mU][mU][mC][mC][mUs][m As][mA][G1b][G1b][G1b] 3′);

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: SEQ ID: 234 (5′ [mUs][fUs][fC][mA][fA][mC][fA][mA][mG][fA][mA][mA][mA][fA][mC][fC][mC][mC][mG][mCs][mCs][mU] 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 244 (5′ [mGs][mCs][mG][mG][mG][fG][mU][fU][fU][fU][fU][mC][mU][mU][mG][mU][mU][mGs][m As][mA][G1b][G1b][G1b] 3′);

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: SEQ ID: 235 (5′ [mUs][fUs][fU][mG][fU][mC][fA][mA][mC][fA][mA][mG][mA][fA][mA][fA][mA][mC][mC][mCs][mCs][mG] 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 245 (5′ [mGs][mGs][mG][mU][mU][fU][mU][fU][fC][fU][fU][mG][mU][mU][mG][mA][mC][mAs][m As][mA][G1b][G1b][G1b] 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID NO: SEQ ID: 236 (5′ [mUs][fUs][fA][mU][fU][mG][fU][mG][mA][fG][mG][mA][mU][fU][mC][fU][mU][mG][mU][mCs][mAs][mA] 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 246 (5′ [mGs][mAs][mC][mA][mA][fG][mA][fA][fU][fC][fC][mU][mC][mA][mC][mA][mA][mUs][m As][mA][G1b][G1b][G1b] 3′);

vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: SEQ ID: 237 (5′ [mUs][fUs][fA][mG][fG][mA][fA][mU][mU][fU][mU][mC][mC][fG][mA][fA][mA][mG][mC][mCs][mCs][mA] 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 247 (5′ [mGs][mGs][mC][mU][mU][fU][mC][fG][fG][fA][fA][mA][mA][mU][mU][mC][mC][mUs][mAs][mA][G1b][G1b][G1b] 3′);

vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: SEQ ID: 238 (5′ [mUs][fAs][fU][mA][fA][mC][fU][mG][mA][fA][mA][mG][mC][fC][mA][fA][mA][mC][mA][mGs][mUs][mG] 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 248 (5′ [mCs][mUs][mG][mU][mU][fU][mG][fG][fC][fU][fU][mU][mC][mA][mG][mU][mU][mAs][m Us][mA][G1b][G1b][G1b] 3);

viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: SEQ ID: 239 (5′ [mUs][fAs][fG][mA][fA][mA][fA][mU][mU][fG][mG][mU][mA][fA][mC][fA][mG][mC][mG][mGs][mUs][mA] 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 249 (5′ [mCs][mCs][mG][mC][mU][fG][mU][fU][fA][fC][fC][mA][mA][mU][mU][mU][mU][mCs][m Us][mA][G1b][G1b][G1b] 3′);

ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: SEQ ID: 240 (5′ [mUs][fAs][fA][mA][fA][mG][fA][mA][mA][fA][mU][mU][mG][fG][mU][fA][mA][mC][mA][mGs][mCs][mG] 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 250 (5′ [mCs][mUs][mG][mU][mU][fA][mC][fC][fA][fA][fU][mU][mU][mU][mC][mU][mU][mUs][m Us][mA][G1b][G1b][G1b] 3′); or

x) an antisense strand of nucleic acid sequence according to SEQ ID NO: SEQ ID: 241 (5′ [mUs][fAs][fC][mA][fA][mA][fA][mG][mA][fA][mA][mA][mU][fU][mG][fG][mU][mA][mA][mCs][mAs][mG] 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 251 (5′ [mGs][mUs][mU][mA][mC][fC][mA][fA][fU][fU][fU][mU][mC][mU][mU][mU][mU][mGs][m Us][mA][G1b][G1b][G1b] 3′).

47 . A vector encoding the isolated oligonucleotide of claim 1 .

48 . A delivery system comprising the isolated oligonucleotide of claim 1 .

49 . A pharmaceutical composition comprising at least one isolated oligonucleotide of claim 1 , and a pharmaceutically acceptable carrier, diluent or excipient.

50 . (canceled)

51 . A method of inhibiting or downregulating the expression or level of HBV or HBsAg or treating or preventing a disease or disorder associated with aberrant or increased expression or activity of HBV or HBsAg or a disease or disorder where HBV or HBsAg plays a role in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of at least one isolated oligonucleotide of claim 1 .

52 . (canceled)

53 . The isolated oligonucleotide of claim 28 , wherein the antisense strand comprises nucleotides modified with 2′-F modification, and nucleotides modified with 2′-O-methyl modification, according to the formula:

3′( M ) 0 ( F ) 0 ( M ) 6 ( F ) 1 ( M ) 1 ( F ) 1 ( M ) 3 ( F ) 1 ( M ) 2 ( F ) 1 ( M ) 1 ( F ) 1 ( M ) 1 ( F ) 2 ( M ) 1 5′.

54 . The isolated oligonucleotide of claim 28 , wherein the sense strand comprises nucleotides modified with 2′-F modification, and nucleotides modified with 2′-O-methyl modification, according to the formula:

5′( M ) 0 ( F ) 0 ( M ) 5 ( F ) 1 ( M ) 1 ( F ) 4 ( M ) 9 3′.

55 . A vector encoding the isolated oligonucleotide of claim 28 .

56 . A delivery system comprising the isolated oligonucleotide of claim 28 .

57 . A pharmaceutical composition comprising at least one isolated oligonucleotide of claim 28 , and a pharmaceutically acceptable carrier, diluent or excipient.

58 . A method of inhibiting or downregulating the expression or level of HBV or HBsAg or treating or preventing a disease or disorder associated with aberrant or increased expression or activity of HBV or HBsAg or a disease or disorder where HBV or HBsAg plays a role in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of at least one isolated oligonucleotide of claim 28 .

59 . The isolated oligonucleotide of claim 33 , wherein the antisense strand comprises nucleotides modified with 2′-F modification, and nucleotides modified with 2′-O-methyl modification, according to the formula:

3′( M ) 0 ( F ) 0 ( M ) 6 ( F ) 1 ( M ) 1 ( F ) 1 ( M ) 3 ( F ) 1 ( M ) 2 ( F ) 1 ( M ) 1 ( F ) 1 ( M ) 1 ( F ) 2 ( M ) 1 5′.

60 . The isolated oligonucleotide of claim 33 , wherein the sense strand comprises nucleotides modified with 2′-F modification, and nucleotides modified with 2′-O-methyl modification, according to the formula:

5′( M ) 0 ( F ) 0 ( M ) 5 ( F ) 1 ( M ) 1 ( F ) 4 ( M ) 9 3′.

61 . A vector encoding the isolated oligonucleotide of claim 33 .

62 . A delivery system comprising the isolated oligonucleotide of claim 33 .

63 . A pharmaceutical composition comprising at least one isolated oligonucleotide of claim 33 , and a pharmaceutically acceptable carrier, diluent or excipient.

64 . A method of inhibiting or downregulating the expression or level of HBV or HBsAg or treating or preventing a disease or disorder associated with aberrant or increased expression or activity of HBV or HBsAg or a disease or disorder where HBV or HBsAg plays a role in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of at least one isolated oligonucleotide of claim 33 .

Assignments (4)

ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Dec 18, 2025

From: SANEGENE BIO INC.

To: SANEGENE BIO USA INC.

Reel/Frame 073966/0761 →

ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Jun 12, 2024

From: JIN, YUYAN

To: SUZHOU SANEGENE BIO INC.

Reel/Frame 067701/0951 →

ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Jun 12, 2024

From: ZHANG, CHUNYANG; YANG, ZHONGFA; WANG, SHIYU; WANG, WEIMIN

To: SANEGENE BIO USA INC.

Reel/Frame 067701/0959 →

ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Jun 12, 2024

From: SANEGENE BIO USA INC.

To: SUZHOU SANEGENE BIO INC.

Reel/Frame 067701/0970 →