SMALL INTERFERING RNA TARGETING APOC3 AND USES THEREOF
This disclosure relates to isolated oligonucleotides comprising duplex regions targeting human apolipoprotein C3 (ApoC3) mRNA, and delivery systems, kits and compositions comprising the same, and methods of using the same for inhibiting or downregulating ApoC3 gene expression.
1 . An isolated oligonucleotide comprising a sense strand and an antisense strand, wherein:
the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising 19-25 nucleotides between any one of the nucleotide positions selected from:
a) 52 to 204;
b) 227 to 310;
c) 356 to 380;
d) 415 to 470; and
e) 505 to 534,
from the 5′ end of a human ApoC3 mRNA sequence according to SEQ ID NO: 1,
and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double stranded region.
2 .- 3 . (canceled)
4 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a nucleotide sequence that is substantially identical to a region between any one of the nucleotide positions selected from:
a) 90 to 110;
b) 130 to 204; and
c) 356 to 378,
from the 5′ end of a human ApoC3 mRNA sequence according to SEQ ID NO: 1.
5 .- 6 . (canceled)
7 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a nucleotide sequence that is substantially identical to a region between any one of the nucleotide positions selected from:
a) 52 to 82;
b) 113 to 194;
c) 227 to 310;
d) 360 to 380;
e) 429 to 470; and
f) 505 to 525,
from the 5′ end of a human ApoC3 mRNA sequence according to SEQ ID NO: 1.
8 .- 9 . (canceled)
10 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a nucleotide sequence that is substantially identical to a region between any one of the nucleotide positions selected from:
a) 114 to 134;
b) 274 to 294;
c) 415 to 464; and
d) 513 to 533,
from the 5′ end of a human ApoC3 mRNA sequence according to SEQ ID NO: 1.
11 .- 20 . (canceled)
21 . The isolated oligonucleotide of claim 1 , wherein the antisense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 2-46, 92-183, 276-375, 476-503, or 532-543.
22 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 47-91, 184-275, 376-475, 504-531, or 544-555.
23 . The isolated oligonucleotide of claim 4 , wherein the double stranded region comprises: i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 7 (5′ UUGAAGCUCGGGCAGAGGCCAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 52 (5′ GGCCUCUGCCCGAGCUUCAA 3′); ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 11 (5′ UAACCCUGCAUGAAGCUGAGAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 56 (5′ CUCAGCUUCAUGCAGGGUUA 3′); iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 14 (5′ UCGGUCUUGGUGGCGUGCUUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 59 (5′ AAGCACGCCACCAAGACCGA 3′); iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 17 (5′ UACUCCUGCACGCUGCUCAGUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 62 (5′ CUGAGCAGCGUGCAGGAGUA 3′); v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 28 (5′ UUAGGCAGGUGGACUUGGGGUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 73 (5′ CCCCAAGUCCACCUGCCUAA 3′); vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 29 (5′ UAUAGGCAGGUGGACUUGGGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 74 (5′ CCCAAGUCCACCUGCCUAUA 3′); or vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 30 (5′ UGAUAGGCAGGUGGACUUGGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 75 (5′ CCAAGUCCACCUGCCUAUCA 3′).
24 . The isolated oligonucleotide of claim 7 , wherein the double stranded region comprises:
i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 2 (5′ UCAACAAGGAGUACCCGGGGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 47 (5′ CCCCGGGUACUCCUUGUUGA 3′);
ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 3 (5′ UAACAACAAGGAGUACCCGGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 48 (5′ CCGGGUACUCCUUGUUGUUA 3′);
iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 4 (5′ UCAACAACAAGGAGUACCCGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 49 (5′ CGGGUACUCCUUGUUGUUGA 3′);
iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 5 (5′ UGCAACAACAAGGAGUACCCGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 50 (5′ GGGUACUCCUUGUUGUUGCA 3′);
v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 6 (5′ UAGGAGGGCAACAACAAGGAGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 51 (5′ UCCUUGUUGUUGCCCUCCUA 3′);
vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 8 (5′ UAGAAGGGAGGCAUCCUCGGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 53 (5′ CCGAGGAUGCCUCCCUUCUA 3′);
vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 10 (5′ UAUGAAGCUGAGAAGGGAGGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 55 (5′ CCUCCCUUCUCAGCUUCAUA 3′);
viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 12 (5′ UAUGUAACCCUGCAUGAAGCUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 57 (5′ GCUUCAUGCAGGGUUACAUA 3′);
ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 13 (5′ UGUCUUGGUGGCGUGCUUCAUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 58 (5′ UGAAGCACGCCACCAAGACA 3′);
x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 15 (5′ UCAUCCUUGGCGGUCUUGGUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 60 (5′ ACCAAGACCGCCAAGGAUGA 3′);
xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 16 (5′ UGCUGCUCAGUGCAUCCUUGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 61 (5′ CAAGGAUGCACUGAGCAGCA 3′);
xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 18 (5′ UAAGCCAUCGGUCACCCAGCCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 63 (5′ GCUGGGUGACCGAUGGCUUA 3′);
xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 19 (5′ UGAACUGAAGCCAUCGGUCACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 64 (5′ UGACCGAUGGCUUCAGUUCA 3′);
xiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 20 (5′ UGAGAACUUGUCCUUAACGGUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 65 (5′ CCGUUAAGGACAAGUUCUCA 3′);
xv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 21 (5′ UAGAGAACUUGUCCUUAACGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 66 (5′ CGUUAAGGACAAGUUCUCUA 3′);
xvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 23 (5′ UAACUCAGAGAACUUGUCCUUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 68 (5′ AGGACAAGUUCUCUGAGUUA 3′);
xvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 24 (5′ UAGAACUCAGAGAACUUGUCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 69 (5′ GACAAGUUCUCUGAGUUCUA 3′);
xviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 25 (5′ UCAGAACUCAGAGAACUUGUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 70 (5′ ACAAGUUCUCUGAGUUCUGA 3′);
xix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 26 (5′ UCAAAUCCCAGAACUCAGAGAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 71 (5′ CUCUGAGUUCUGGGAUUUGA 3′);
xx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 27 (5′ UUCCAAAUCCCAGAACUCAGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 72 (5′ CUGAGUUCUGGGAUUUGGAA 3′);
xxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 31 (5′ UUGGAUAGGCAGGUGGACUUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 76 (5′ AAGUCCACCUGCCUAUCCAA 3′);
xxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 33 (5′ UAAUACUGUCCCUUUUAAGCAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 78 (5′ GCUUAAAAGGGACAGUAUUA 3′);
xxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 36 (5′ UCUGAGAAUACUGUCCCUUUUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 81 (5′ AAAGGGACAGUAUUCUCAGA 3′);
xxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 42 (5′ UGUAGGAGAGCACUGAGAAUAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 87 (5′ AUUCUCAGUGCUCUCCUACA 3′);
xxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 43 (5′ UGGGGUAGGAGAGCACUGAGAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 88 (5′ CUCAGUGCUCUCCUACCCCA 3′);
xxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 44 (5′ UGUGGGGUAGGAGAGCACUGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 89 (5′ CAGUGCUCUCCUACCCCACA 3′); or
xxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 45 (5′ UUUCUUGUCCAGCUUUAUUGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 90 (5′ CAAUAAAGCUGGACAAGAAA 3′).
25 . The isolated oligonucleotide of claim 10 , wherein the double stranded region comprises:
i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 9 (5′ UGAGAAGGGAGGCAUCCUCGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 54 (5′ CGAGGAUGCCUCCCUUCUCA 3′);
ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 22 (5′ UCAGAGAACUUGUCCUUAACGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 67 (5′ GUUAAGGACAAGUUCUCUGA 3′);
iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 32 (5′ UUAAGCAACCUACAGGGGCAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 77 (5′ UGCCCCUGUAGGUUGCUUAA 3′);
iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 35 (5′ UGAAUACUGUCCCUUUUAAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 80 (5′ CUUAAAAGGGACAGUAUUCA 3′)
v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 38 (5′ UCACUGAGAAUACUGUCCCUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 83 (5′ AGGGACAGUAUUCUCAGUGA 3′);
vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 39 (5′ UAGCACUGAGAAUACUGUCCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 84 (5′ GGACAGUAUUCUCAGUGCUA 3′);
vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 40 (5′ UGGAGAGCACUGAGAAUACUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 85 (5′ AGUAUUCUCAGUGCUCUCCA 3′);
viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 41 (5′ UUAGGAGAGCACUGAGAAUACU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 86 (5′ UAUUCUCAGUGCUCUCCUAA 3′); or
ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 46 (5′ UAUAGCAGCUUCUUGUCCAGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 91 (5′ CUGGACAAGAAGCUGCUAUA 3′).
26 . (canceled)
27 . The isolated oligonucleotide of claim 1 , wherein the double stranded region comprises:
i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 7 (5′ UUGAAGCUCGGGCAGAGGCCAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 52 (5′ GGCCUCUGCCCGAGCUUCAA 3′);
ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 11 (5′ UAACCCUGCAUGAAGCUGAGAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 56 (5′ CUCAGCUUCAUGCAGGGUUA 3′);
iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 14 (5′ UCGGUCUUGGUGGCGUGCUUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 59 (5′ AAGCACGCCACCAAGACCGA 3′);
iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 28 (5′ UUAGGCAGGUGGACUUGGGGUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 73 (5′ CCCCAAGUCCACCUGCCUAA 3′);
v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 29 (5′ UAUAGGCAGGUGGACUUGGGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 74 (5′ CCCAAGUCCACCUGCCUAUA 3′);
vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 30 (5′ UGAUAGGCAGGUGGACUUGGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 75 (5′ CCAAGUCCACCUGCCUAUCA 3′);
vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 2 (5′ UCAACAAGGAGUACCCGGGGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 47 (5′ CCCCGGGUACUCCUUGUUGA 3′);
viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 3 (5′ UAACAACAAGGAGUACCCGGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 48 (5′ CCGGGUACUCCUUGUUGUUA 3′);
ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 4 (5′ UCAACAACAAGGAGUACCCGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 49 (5′ CGGGUACUCCUUGUUGUUGA 3′);
x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 5 (5′ UGCAACAACAAGGAGUACCCGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 50 (5′ GGGUACUCCUUGUUGUUGCA 3′);
xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 6 (5′ UAGGAGGGCAACAACAAGGAGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 51 (5′ UCCUUGUUGUUGCCCUCCUA 3′);
xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 8 (5′ UAGAAGGGAGGCAUCCUCGGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 53 (5′ CCGAGGAUGCCUCCCUUCUA 3′);
xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 10 (5′ UAUGAAGCUGAGAAGGGAGGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 55 (5′ CCUCCCUUCUCAGCUUCAUA 3′);
xiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 13 (5′ UGUCUUGGUGGCGUGCUUCAUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 58 (5′ UGAAGCACGCCACCAAGACA 3′);
xv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 15 (5′ UCAUCCUUGGCGGUCUUGGUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 60 (5′ ACCAAGACCGCCAAGGAUGA 3′);
xvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 16 (5′ UGCUGCUCAGUGCAUCCUUGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 61 (5′ CAAGGAUGCACUGAGCAGCA 3′);
xvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 18 (5′ UAAGCCAUCGGUCACCCAGCCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 63 (5′ GCUGGGUGACCGAUGGCUUA 3′);
xviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 19 (5′ UGAACUGAAGCCAUCGGUCACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 64 (5′ UGACCGAUGGCUUCAGUUCA 3′);
xix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 20 (5′ UGAGAACUUGUCCUUAACGGUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 65 (5′ CCGUUAAGGACAAGUUCUCA 3′);
xx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 21 (5′ UAGAGAACUUGUCCUUAACGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 66 (5′ CGUUAAGGACAAGUUCUCUA 3′);
xxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 23 (5′ UAACUCAGAGAACUUGUCCUUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 68 (5′ AGGACAAGUUCUCUGAGUUA 3′);
xxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 24 (5′ UAGAACUCAGAGAACUUGUCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 69 (5′ GACAAGUUCUCUGAGUUCUA 3′);
xxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 25 (5′ UCAGAACUCAGAGAACUUGUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 70 (5′ ACAAGUUCUCUGAGUUCUGA 3′);
xxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 31 (5′ UUGGAUAGGCAGGUGGACUUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 76 (5′ AAGUCCACCUGCCUAUCCAA 3′);
xxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 33 (5′ UAAUACUGUCCCUUUUAAGCAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 78 (5′ GCUUAAAAGGGACAGUAUUA 3′);
xxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 36 (5′ UCUGAGAAUACUGUCCCUUUUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 81 (5′ AAAGGGACAGUAUUCUCAGA 3′);
xxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 42 (5′ UGUAGGAGAGCACUGAGAAUAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 87 (5′ AUUCUCAGUGCUCUCCUACA 3′);
xxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 43 (5′ UGGGGUAGGAGAGCACUGAGAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 88 (5′ CUCAGUGCUCUCCUACCCCA 3′);
xxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 44 (5′ UGUGGGGUAGGAGAGCACUGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 89 (5′ CAGUGCUCUCCUACCCCACA 3′);
xxx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 45 (5′ UUUCUUGUCCAGCUUUAUUGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 90 (5′ CAAUAAAGCUGGACAAGAAA 3′);
xxxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 9 (5′ UGAGAAGGGAGGCAUCCUCGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 54 (5′ CGAGGAUGCCUCCCUUCUCA 3′);
xxxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 22 (5′ UCAGAGAACUUGUCCUUAACGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 67 (5′ GUUAAGGACAAGUUCUCUGA 3′);
xxxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 32 (5′ UUAAGCAACCUACAGGGGCAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 77 (5′ UGCCCCUGUAGGUUGCUUAA 3′);
xxxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 35 (5′ UGAAUACUGUCCCUUUUAAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 80 (5′ CUUAAAAGGGACAGUAUUCA 3′);
xxxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 38 (5′ UCACUGAGAAUACUGUCCCUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 83 (5′ AGGGACAGUAUUCUCAGUGA 3′);
xxxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 39 (5′ UAGCACUGAGAAUACUGUCCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 84 (5′ GGACAGUAUUCUCAGUGCUA 3′);
xxxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 40 (5′ UGGAGAGCACUGAGAAUACUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 85 (5′ AGUAUUCUCAGUGCUCUCCA 3′);
xxxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 41 (5′ UUAGGAGAGCACUGAGAAUACU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 86 (5′ UAUUCUCAGUGCUCUCCUAA 3′);
xxxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 46 (5′ UAUAGCAGCUUCUUGUCCAGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 91 (5′ CUGGACAAGAAGCUGCUAUA 3′), or
i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 17 (5′ UACUCCUGCACGCUGCUCAGUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 62 (5′ CUGAGCAGCGUGCAGGAGUA 3′);
ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 12 (5′ UAUGUAACCCUGCAUGAAGCUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 57 (5′ GCUUCAUGCAGGGUUACAUA 3′);
iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 26 (5′ UCAAAUCCCAGAACUCAGAGAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 71 (5′ CUCUGAGUUCUGGGAUUUGA 3′); or
iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 27 (5′ UUCCAAAUCCCAGAACUCAGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 72 (5′ CUGAGUUCUGGGAUUUGGAA 3′).
28 . (canceled)
29 . (canceled)
30 . An isolated oligonucleotide comprising a sense strand and an antisense strand, wherein:
the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising 19-25 nucleotides between any one of the nucleotide positions selected from:
a) 14 to 208;
b) 222 to 480; and
c) 488 to 534,
from the 5′ end of a ApoC3 mRNA sequence according to SEQ ID NO: 1,
and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double stranded region.
31 . (canceled)
32 . The isolated oligonucleotide of claim 30 , wherein the double stranded region comprises:
i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 92 (5′ UUUAUUGGGAGGCCAGCAUGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 184 (5′ CAUGCUGGCCUCCCAAUAAA 3′);
ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 93 (5′ UUAUUGGGAGGCCAGCAUGCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 185 (5′ GCAUGCUGGCCUCCCAAUAA 3′);
iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 94 (5′ UCUGCAUGAAGCUGAGAAGGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 186 (5′ CCUUCUCAGCUUCAUGCAGA 3′);
iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 95 (5′ UAGUACCCGGGGCUGCAUGGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 187 (5′ CCAUGCAGCCCCGGGUACUA 3′);
v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 96 (5′ UGAACUCAGAGAACUUGUCCUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 188 (5′ GGACAAGUUCUCUGAGUUCA 3′);
vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 97 (5′ UCUGCAUGGCACCUCUGUUCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 189 (5′ GAACAGAGGUGCCAUGCAGA 3′);
vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 98 (5′ UCUGCUCAGUGCAUCCUUGGCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 190 (5′ CCAAGGAUGCACUGAGCAGA 3′);
viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 99 (5′ UCAAGGAGUACCCGGGGCUGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 191 (5′ CAGCCCCGGGUACUCCUUGA 3′);
ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 500 (5′ UAGGAGAGCACUGAGAAUACUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 528 (5′ GUAUUCUCAGUGCUCUCCUA 3′);
x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 493 (5′ UUCAGAGAACUUGUCCUUAACG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 521 (5′ UUAAGGACAAGUUCUCUGAA 3′);
xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 499 (5′ UGAGAGCACUGAGAAUACUGUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 527 (5′ CAGUAUUCUCAGUGCUCUCA 3′);
xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 495 (5′ UUGAGAAUACUGUCCCUUUUAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 523 (5′ AAAAGGGACAGUAUUCUCAA 3′);
xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 492 (5′ UAGAACUUGUCCUUAACGGUGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 520 (5′ ACCGUUAAGGACAAGUUCUA 3′);
xiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 502 (5′ UUGGGGUAGGAGAGCACUGAGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 530 (5′ UCAGUGCUCUCCUACCCCAA 3′);
xv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 494 (5′ UACUCAGAGAACUUGUCCUUAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 522 (5′ AAGGACAAGUUCUCUGAGUA 3′);
xvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 498 (5′ UGAGCACUGAGAAUACUGUCCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 526 (5′ GACAGUAUUCUCAGUGCUCA 3′);
xvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 501 (5′ UGGGUAGGAGAGCACUGAGAAU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 529 (5′ UCUCAGUGCUCUCCUACCCA 3′);
xviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 483 (5′ UUGAGAAGGGAGGCAUCCUCGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 511 (5′ GAGGAUGCCUCCCUUCUCAA 3′);
xix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 476 (5′ UACAACAAGGAGUACCCGGGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 504 (5′ CCCGGGUACUCCUUGUUGUA 3′);
xx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 491 (5′ UAACUUGUCCUUAACGGUGCUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 519 (5′ GCACCGUUAAGGACAAGUUA 3′);
xxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 478 (5′ UAGGGCAACAACAAGGAGUACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 506 (5′ UACUCCUUGUUGUUGCCCUA 3′);
xxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 497 (5′ UGCACUGAGAAUACUGUCCCUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 525 (5′ GGGACAGUAUUCUCAGUGCA 3′); or
xxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 496 (5′ UACUGAGAAUACUGUCCCUUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 524 (5′ AAGGGACAGUAUUCUCAGUA 3′), or
i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 100 (5′ UGUCUUUCAGGGAACUGAAGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 192 (5′ CUUCAGUUCCCUGAAAGACA 3′);
ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 101 (5′ UCUCUGUUCCUGGAGCAGCUGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 193 (5′ AGCUGCUCCAGGAACAGAGA 3′);
iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 102 (5′ UUUUAAGCAACCUACAGGGGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 194 (5′ CCCCUGUAGGUUGCUUAAAA 3′);
iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 103 (5′ UAGGGAGGCAUCCUCGGCCUCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 195 (5′ AGGCCGAGGAUGCCUCCCUA 3′);
v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 104 (5′ UCUUCUUGUCCAGCUUUAUUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 196 (5′ AAUAAAGCUGGACAAGAAGA 3′);
vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 105 (5′ UUGGCACCUCUGUUCCUGGAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 197 (5′ UCCAGGAACAGAGGUGCCAA 3′);
vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 106 (5′ UUUUAUUGGGAGGCCAGCAUGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 198 (5′ AUGCUGGCCUCCCAAUAAAA 3′);
viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 107 (5′ UCUGUUCCUGGAGCAGCUGCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 199 (5′ GCAGCUGCUCCAGGAACAGA 3′);
ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 108 (5′ UAGGAUGGAUAGGCAGGUGGAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 200 (5′ CCACCUGCCUAUCCAUCCUA 3′);
x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 109 (5′ UGAAGUUGGUCUGACCUCAGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 201 (5′ CUGAGGUCAGACCAACUUCA 3′);
xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 110 (5′ UAGGACCCAAGGAGCUCGCAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 202 (5′ UGCGAGCUCCUUGGGUCCUA 3′);
xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 111 (5′ UUGCAUGGCACCUCUGUUCCUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 203 (5′ GGAACAGAGGUGCCAUGCAA 3′);
xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 112 (5′ UCAUCGGUCACCCAGCCCCUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 204 (5′ AGGGGCUGGGUGACCGAUGA 3′);
xiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 113 (5′ UCUGAGAAGGGAGGCAUCCUCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 205 (5′ AGGAUGCCUCCCUUCUCAGA 3′);
xv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 114 (5′ UUCGCAGGAUGGAUAGGCAGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 206 (5′ CUGCCUAUCCAUCCUGCGAA 3′);
xvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 115 (5′ UCGUGCUUCAUGUAACCCUGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 207 (5′ CAGGGUUACAUGAAGCACGA 3′);
xvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 116 (5′ UCAUAGCAGCUUCUUGUCCAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 208 (5′ UGGACAAGAAGCUGCUAUGA 3′);
xviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 117 (5′ UAGCUGAGAAGGGAGGCAUCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 209 (5′ GAUGCCUCCCUUCUCAGCUA 3′);
xix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 118 (5′ UCUGACCUCAGGGUCCAAAUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 210 (5′ AUUUGGACCCUGAGGUCAGA 3′);
xx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 119 (5′ UCGCCAGGAGGGCAACAACAAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 211 (5′ UGUUGUUGCCCUCCUGGCGA 3′);
xxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 120 (5′ UGAGAUUGCAGGACCCAAGGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 212 (5′ CCUUGGGUCCUGCAAUCUCA 3′);
xxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 121 (5′ UGAGCUCGCAGGAUGGAUAGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 213 (5′ CUAUCCAUCCUGCGAGCUCA 3′);
xxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 122 (5′ UUGGUGGCGUGCUUCAUGUAAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 214 (5′ UACAUGAAGCACGCCACCAA 3′);
xxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 123 (5′ UAGGAGCUCGCAGGAUGGAUAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 215 (5′ AUCCAUCCUGCGAGCUCCUA 3′);
xxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 124 (5′ UAAUCCCAGAACUCAGAGAACU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 216 (5′ UUCUCUGAGUUCUGGGAUUA 3′);
xxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 125 (5′ UCCAGAACUCAGAGAACUUGUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 217 (5′ CAAGUUCUCUGAGUUCUGGA 3′);
xxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 126 (5′ UCAGGGAACUGAAGCCAUCGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 218 (5′ CGAUGGCUUCAGUUCCCUGA 3′);
xxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 127 (5′ UUUUUAAGCAACCUACAGGGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 219 (5′ CCCUGUAGGUUGCUUAAAAA 3′);
xxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 128 (5′ UCAAGGAGCUCGCAGGAUGGAU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 220 (5′ CCAUCCUGCGAGCUCCUUGA 3′);
xxx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 129 (5′ UUGCUCAGUGCAUCCUUGGCGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 221 (5′ GCCAAGGAUGCACUGAGCAA 3′);
xxxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 130 (5′ UAGGUGGGGUAGGAGAGCACUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 222 (5′ GUGCUCUCCUACCCCACCUA 3′);
xxxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 131 (5′ UUUGUCCAGCUUUAUUGGGAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 223 (5′ UCCCAAUAAAGCUGGACAAA 3′);
xxxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 132 (5′ UGUUGGUCUGACCUCAGGGUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 224 (5′ ACCCUGAGGUCAGACCAACA 3′);
xxxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 133 (5′ UCUUUCAGGGAACUGAAGCCAU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 225 (5′ GGCUUCAGUUCCCUGAAAGA 3′);
xxxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 134 (5′ UACGCUGCUCAGUGCAUCCUUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 226 (5′ AGGAUGCACUGAGCAGCGUA 3′);
xxxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 135 (5′ UAUUGGGAGGCCAGCAUGCCUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 227 (5′ GGCAUGCUGGCCUCCCAAUA3′);
xxxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 136 (5′ UGUCCCUUUUAAGCAACCUACA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 228 (5′ UAGGUUGCUUAAAAGGGACA 3′);
xxxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 137 (5′ UAGAGGCCAGGAGCGCCAGGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 229 (5′ CCUGGCGCUCCUGGCCUCUA 3′);
xxxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 138 (5′ UCAUGAAGCUGAGAAGGGAGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 230 (5′ CUCCCUUCUCAGCUUCAUGA 3′);
xL) an antisense strand of nucleic acid sequence according to SEQ ID NO: 139 (5′ UGUCCAGCUUUAUUGGGAGGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 231 (5′ CCUCCCAAUAAAGCUGGACA 3′);
xLi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 140 (5′ UCUGAAGUUGGUCUGACCUCAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 232 (5′ GAGGUCAGACCAACUUCAGA 3′);
xLii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 141 (5′ UGACCCAAGGAGCUCGCAGGAU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 233 (5′ CCUGCGAGCUCCUUGGGUCA 3′);
xLiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 142 (5′ UGCUGCAUGGCACCUCUGUUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 234 (5′ AACAGAGGUGCCAUGCAGCA 3′);
xLiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 143 (5′ UUAUUGAGGUCUCAGGCAGCCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 235 (5′ GCUGCCUGAGACCUCAAUAA 3′);
xLv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 144 (5′ UGAACUUGUCCUUAACGGUGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 236 (5′ CACCGUUAAGGACAAGUUCA 3′);
xLvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 145 (5′ UGAGGUCUCAGGCAGCCACGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 237 (5′ CGUGGCUGCCUGAGACCUCA 3′);
xLvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 146 (5′ UGUGGACUUGGGGUAUUGAGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 238 (5′ CUCAAUACCCCAAGUCCACA 3′);
xLviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 147 (5′ UGAGUACCCGGGGCUGCAUGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 239 (5′ CAUGCAGCCCCGGGUACUCA 3′);
xLix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 148 (5′ UAAGUUGGUCUGACCUCAGGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 240 (5′ CCUGAGGUCAGACCAACUUA 3′);
L) an antisense strand of nucleic acid sequence according to SEQ ID NO: 149 (5′ UGCAGGAUGGAUAGGCAGGUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 241 (5′ ACCUGCCUAUCCAUCCUGCA 3′);
Li) an antisense strand of nucleic acid sequence according to SEQ ID NO: 150 (5′ UGUUCCUGGAGCAGCUGCCUCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 242 (5′ AGGCAGCUGCUCCAGGAACA 3′);
Lii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 151 (5′ UGGCAGCCACGGCUGAAGUUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 243 (5′ AACUUCAGCCGUGGCUGCCA 3′);
Liii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 152 (5′ UCUGGAGCAGCUGCCUCUAGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 244 (5′ CUAGAGGCAGCUGCUCCAGA 3′);
Liv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 153 (5′ UAUGAGGUGGGGUAGGAGAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 245 (5′ CUCUCCUACCCCACCUCAUA 3′);
Lv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 154 (5′ UAGGUCUCAGGCAGCCACGGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 246 (5′ CCGUGGCUGCCUGAGACCUA 3′);
Lvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 155 (5′ UAUCGGUCACCCAGCCCCUGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 247 (5′ CAGGGGCUGGGUGACCGAUA 3′);
Lvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 156 (5′ UCAGAGGCCAGGAGCGCCAGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 248 (5′ CUGGCGCUCCUGGCCUCUGA 3′);
Lviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 157 (5′ UUGGGACUCCUGCACGCUGCUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 249 (5′ GCAGCGUGCAGGAGUCCCAA 3′);
Lix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 158 (5′ UCACGGCUGAAGUUGGUCUGAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 250 (5′ CAGACCAACUUCAGCCGUGA 3′);
Lx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 159 (5′ UUGGAGAUUGCAGGACCCAAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 251 (5′ UUGGGUCCUGCAAUCUCCAA 3′);
Lxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 160 (5′ UAGGCCAGGAGCGCCAGGAGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 252 (5′ CUCCUGGCGCUCCUGGCCUA 3′);
Lxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 161 (5′ UGUAGUCUUUCAGGGAACUGAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 253 (5′ CAGUUCCCUGAAAGACUACA 3′);
Lxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 162 (5′ UGGUAGGAGAGCACUGAGAAUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 254 (5′ UUCUCAGUGCUCUCCUACCA 3′);
Lxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 163 (5′ UGUGCUCCAGUAGUCUUUCAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 255 (5′ UGAAAGACUACUGGAGCACA 3′);
Lxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 164 (5′ UUUGGGAGGCCAGCAUGCCUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 256 (5′ AGGCAUGCUGGCCUCCCAAA 3′);
Lxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 165 (5′ UGGUCCAAAUCCCAGAACUCAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 257 (5′ GAGUUCUGGGAUUUGGACCA 3′);
Lxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 166 (5′ UCUCAGGCAGCCACGGCUGAAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 258 (5′ UCAGCCGUGGCUGCCUGAGA 3′);
Lxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 167 (5′ UUUGGGGUAUUGAGGUCUCAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 259 (5′ UGAGACCUCAAUACCCCAAA 3′);
Lxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 168 (5′ UGAUGGAUAGGCAGGUGGACUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 260 (5′ GUCCACCUGCCUAUCCAUCA 3′);
Lxx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 169 (5′ UCUCAGAGAACUUGUCCUUAAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 261 (5′ UAAGGACAAGUUCUCUGAGA 3′);
Lxxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 170 (5′ UGCAGGACCCAAGGAGCUCGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 262 (5′ CGAGCUCCUUGGGUCCUGCA 3′);
Lxxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 171 (5′ UUCGGGCAGAGGCCAGGAGCGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 263 (5′ GCUCCUGGCCUCUGCCCGAA 3′);
Lxxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 172 (5′ UUUAACGGUGCUCCAGUAGUCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 264 (5′ ACUACUGGAGCACCGUUAAA 3′);
Lxxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 173 (5′ UUUGCAGGACCCAAGGAGCUCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 265 (5′ AGCUCCUUGGGUCCUGCAAA 3′);
Lxxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 174 (5′ UGCAGAGGCCAGGAGCGCCAGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 266 (5′ UGGCGCUCCUGGCCUCUGCA 3′);
Lxxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 175 (5′ UCUUUAUUGGGAGGCCAGCAUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 267 (5′ UGCUGGCCUCCCAAUAAAGA 3′);
Lxxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 176 (5′ UCUUUUAAGCAACCUACAGGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 268 (5′ CCUGUAGGUUGCUUAAAAGA 3′);
Lxxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 177 (5′ UCAGCUUUAUUGGGAGGCCAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 269 (5′ UGGCCUCCCAAUAAAGCUGA 3′);
Lxxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 178 (5′ UAGGGUCCAAAUCCCAGAACUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 270 (5′ GUUCUGGGAUUUGGACCCUA 3′);
Lxxx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 179 (5′ UCUGCACGCUGCUCAGUGCAUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 271 (5′ UGCACUGAGCAGCGUGCAGA 3′);
Lxxxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 180 (5′ UCAUGGCACCUCUGUUCCUGGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 272 (5′ CAGGAACAGAGGUGCCAUGA 3′);
Lxxxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 181 (5′ UGCUGAAGUUGGUCUGACCUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 273 (5′ AGGUCAGACCAACUUCAGCA 3′);
Lxxxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 182 (5′ UAGGCAUCCUCGGCCUCUGAAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 274 (5′ UCAGAGGCCGAGGAUGCCUA 3′);
Lxxxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 183 (5′ UUCCCAGAACUCAGAGAACUUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 275 (5′ AGUUCUCUGAGUUCUGGGAA 3′);
Lxxxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 490 (5′ UUGUCCUUAACGGUGCUCCAGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 518 (5′ UGGAGCACCGUUAAGGACAA 3′);
Lxxxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 503 (5′ UGGUGGGGUAGGAGAGCACUGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 531 (5′ AGUGCUCUCCUACCCCACCA 3′);
Lxxxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 488 (5′ UUGUAACCCUGCAUGAAGCUGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 516 (5′ AGCUUCAUGCAGGGUUACAA 3′);
Lxxxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 487 (5′ UUAACCCUGCAUGAAGCUGAGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 515 (5′ UCAGCUUCAUGCAGGGUUAA 3′);
Lxxxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 477 (5′ UGGCAACAACAAGGAGUACCCG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 505 (5′ GGUACUCCUUGUUGUUGCCA 3′); or
xc) an antisense strand of nucleic acid sequence according to SEQ ID NO: 485 (5′ UAAGCUGAGAAGGGAGGCAUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 513 (5′ AUGCCUCCCUUCUCAGCUUA 3′), or
i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 7 (5′ UUGAAGCUCGGGCAGAGGCCAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 52 (5′ GGCCUCUGCCCGAGCUUCAA 3′);
ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 11 (5′ UAACCCUGCAUGAAGCUGAGAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 56 (5′ CUCAGCUUCAUGCAGGGUUA 3′);
iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 14 (5′ UCGGUCUUGGUGGCGUGCUUCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 59 (5′ AAGCACGCCACCAAGACCGA 3′);
iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 17 (5′ UACUCCUGCACGCUGCUCAGUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 62 (5′ CUGAGCAGCGUGCAGGAGUA 3′);
v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 28 (5′ UUAGGCAGGUGGACUUGGGGUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 73 (5′ CCCCAAGUCCACCUGCCUAA 3′);
vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 29 (5′ UAUAGGCAGGUGGACUUGGGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 74 (5′ CCCAAGUCCACCUGCCUAUA 3′);
vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 30 (5′ UGAUAGGCAGGUGGACUUGGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 75 (5′ CCAAGUCCACCUGCCUAUCA 3′);
viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 9 (5′ UGAGAAGGGAGGCAUCCUCGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 54 (5′ CGAGGAUGCCUCCCUUCUCA 3′);
xix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 22 (5′ UCAGAGAACUUGUCCUUAACGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 67 (5′ GUUAAGGACAAGUUCUCUGA 3′);
x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 32 (5′ UUAAGCAACCUACAGGGGCAGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 77 (5′ UGCCCCUGUAGGUUGCUUAA 3′);
xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 35 (5′ UGAAUACUGUCCCUUUUAAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 80 (5′ CUUAAAAGGGACAGUAUUCA 3′);
xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 38 (5′ UCACUGAGAAUACUGUCCCUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 83 (5′ AGGGACAGUAUUCUCAGUGA 3′);
xiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 39 (5′ UAGCACUGAGAAUACUGUCCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 84 (5′ GGACAGUAUUCUCAGUGCUA 3′);
xiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 40 (5′ UGGAGAGCACUGAGAAUACUGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 85 (5′ AGUAUUCUCAGUGCUCUCCA 3′);
xv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 41 (5′ UUAGGAGAGCACUGAGAAUACU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 86 (5′ UAUUCUCAGUGCUCUCCUAA 3′);
xvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 46 (5′ UAUAGCAGCUUCUUGUCCAGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 91 (5′ CUGGACAAGAAGCUGCUAUA 3′);
xvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 2 (5′ UCAACAAGGAGUACCCGGGGCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 47 (5′ CCCCGGGUACUCCUUGUUGA 3′);
xviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 3 (5′ UAACAACAAGGAGUACCCGGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 48 (5′ CCGGGUACUCCUUGUUGUUA 3′);
xix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 4 (5′ UCAACAACAAGGAGUACCCGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 49 (5′ CGGGUACUCCUUGUUGUUGA 3′);
xx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 5 (5′ UGCAACAACAAGGAGUACCCGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 50 (5′ GGGUACUCCUUGUUGUUGCA 3′);
xxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 6 (5′ UAGGAGGGCAACAACAAGGAGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 51 (5′ UCCUUGUUGUUGCCCUCCUA 3′);
xxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 8 (5′ UAGAAGGGAGGCAUCCUCGGCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 53 (5′ CCGAGGAUGCCUCCCUUCUA 3′);
xxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 10 (5′ UAUGAAGCUGAGAAGGGAGGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 55 (5′ CCUCCCUUCUCAGCUUCAUA 3′);
xxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 12 (5′ UAUGUAACCCUGCAUGAAGCUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 57 (5′ GCUUCAUGCAGGGUUACAUA 3′);
xxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 13 (5′ UGUCUUGGUGGCGUGCUUCAUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 58 (5′ UGAAGCACGCCACCAAGACA 3′);
xxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 15 (5′ UCAUCCUUGGCGGUCUUGGUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 60 (5′ ACCAAGACCGCCAAGGAUGA 3′);
xxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 16 (5′ UGCUGCUCAGUGCAUCCUUGGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 61 (5′ CAAGGAUGCACUGAGCAGCA 3′);
xxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 18 (5′ UAAGCCAUCGGUCACCCAGCCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 63 (5′ GCUGGGUGACCGAUGGCUUA 3′);
xxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 19 (5′ UGAACUGAAGCCAUCGGUCACC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 64 (5′ UGACCGAUGGCUUCAGUUCA 3′);
xxx) an antisense strand of nucleic acid sequence according to SEQ ID NO: 21 (5′ UAGAGAACUUGUCCUUAACGGU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 66 (5′ CGUUAAGGACAAGUUCUCUA 3′);
xxxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 24 (5′ UAGAACUCAGAGAACUUGUCCU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 69 (5′ GACAAGUUCUCUGAGUUCUA 3′);
xxxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 25 (5′ UCAGAACUCAGAGAACUUGUCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 70 (5′ ACAAGUUCUCUGAGUUCUGA 3′);
xxxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 26 (5′ UCAAAUCCCAGAACUCAGAGAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 71 (5′ CUCUGAGUUCUGGGAUUUGA 3′);
xxxiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 27 (5′ UUCCAAAUCCCAGAACUCAGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 72 (5′ CUGAGUUCUGGGAUUUGGAA 3′);
xxxv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 31 (5′ UUGGAUAGGCAGGUGGACUUGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 76 (5′ AAGUCCACCUGCCUAUCCAA 3′);
xxxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 33 (5′ UAAUACUGUCCCUUUUAAGCAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 78 (5′ GCUUAAAAGGGACAGUAUUA 3′);
xxxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 36 (5′ UCUGAGAAUACUGUCCCUUUUA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 81 (5′ AAAGGGACAGUAUUCUCAGA 3′);
xxxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 42 (5′ UGUAGGAGAGCACUGAGAAUAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 87 (5′ AUUCUCAGUGCUCUCCUACA 3′);
xxxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 43 (5′ UGGGGUAGGAGAGCACUGAGAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 88 (5′ CUCAGUGCUCUCCUACCCCA 3′);
xL) an antisense strand of nucleic acid sequence according to SEQ ID NO: 44 (5′ UGUGGGGUAGGAGAGCACUGAG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 89 (5′ CAGUGCUCUCCUACCCCACA 3′);
xLi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 45 (5′ UUUCUUGUCCAGCUUUAUUGGG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 90 (5′ CAAUAAAGCUGGACAAGAAA 3′);
xLii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 495 (5′ UUGAGAAUACUGUCCCUUUUAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 523 (5′ AAAAGGGACAGUAUUCUCAA 3′);
xLiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 492 (5′ UAGAACUUGUCCUUAACGGUGC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 520 (5′ ACCGUUAAGGACAAGUUCUA 3′);
xLiv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 500 (5′ UAGGAGAGCACUGAGAAUACUG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 528 (5′ GUAUUCUCAGUGCUCUCCUA 3′);
xLv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 498 (5′ UGAGCACUGAGAAUACUGUCCC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 526 (5′ GACAGUAUUCUCAGUGCUCA 3′);
xLvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 499 (5′ UGAGAGCACUGAGAAUACUGUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 527 (5′ CAGUAUUCUCAGUGCUCUCA 3′);
xLvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 494 (5′ UACUCAGAGAACUUGUCCUUAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 522 (5′ AAGGACAAGUUCUCUGAGUA 3′);
xLviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 497 (5′ UGCACUGAGAAUACUGUCCCUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 525 (5′ GGGACAGUAUUCUCAGUGCA 3′);
xLix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 496 (5′ UACUGAGAAUACUGUCCCUUUU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 524 (5′ AAGGGACAGUAUUCUCAGUA 3′);
L) an antisense strand of nucleic acid sequence according to SEQ ID NO: 491 (5′ UAACUUGUCCUUAACGGUGCUC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 519 (5′ GCACCGUUAAGGACAAGUUA 3′);
Li) an antisense strand of nucleic acid sequence according to SEQ ID NO: 501 (5′ UGGGUAGGAGAGCACUGAGAAU 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 529 (5′ UCUCAGUGCUCUCCUACCCA 3′);
Lii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 493 (5′ UUCAGAGAACUUGUCCUUAACG 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 521 (5′ UUAAGGACAAGUUCUCUGAA 3′); or
Liii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 502 (5′ UUGGGGUAGGAGAGCACUGAGA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 530 (5′ UCAGUGCUCUCCUACCCCAA 3′).
33 .- 40 . (canceled)
41 . The isolated oligonucleotide of claim 1 , wherein the antisense strand comprises nucleotides modified with 2′-F modification, and nucleotides modified with 2′-O-methyl modification, according to the formula:
3′(M) 0 (F) 0 (M) 6 (F) 1 (M) 1 (F) 1 (M) 3 (F) 1 (M) 2 (F) 1 (M) 1 (F) i (M) 1 (F) 2 (M) 1 5′.
42 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises nucleotides modified with 2′-F modification, and nucleotides modified with 2′-O-methyl modification, according to the formula:
5′(M) 0 (F) 0 (M) 5 (F) 1 (M) 1 (F) 4 (M) 9 3′.
43 . The isolated oligonucleotide of claim 41 , wherein the antisense strand comprises any one of:
i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 532 (5′ [mUs][fGs][fC][mA][fA][mC][fA][mA][mC][fA][mA][mG][mG][fA][mG][fU][mA][mC][mC][mCs][mGs][mG] 3′);
ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 533 (5′ [mUs][fCs][fA][mG][fA][mG][fA][mA][mC][fU][mU][mG][mU][fC][mC][fU][mU][mA][mA][mCs][mGs][mG] 3′);
iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 534 (5′ [mUs][fAs][fG][mA][fA][mC][fU][mC][mA][fG][mA][mG][mA][fA][mC][fU][mU][mG][mU][mCs][mCs][mU] 3′);
iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 535 (5′ [mUs][fCs][fA][mG][fA][mA][fC][mU][mC][fA][mG][mA][mG][fA][mA][fC][mU][mU][mG][mUs][mCs][mC] 3′);
v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 536 (5′ [mUs][fGs][fA][mA][fU][mA][fC][mU][mG][fU][mC][mC][mC][fU][mU][fU][mU][mA][mA][mGs][mCs][mA] 3′);
vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 537 (5′ [mUs][fCs][fU][mG][fA][mG][fA][mA][mU][fA][mC][mU][mG][fU][mC][fC][mC][mU][mU][mUs][mUs][mA] 3′);
vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 538 (5′ [mUs][fAs][fG][mC][fA][mC][fU][mG][mA][fG][mA][mA][mU][fA][mC][fU][mG][mU][mC][mCs][mCs][mU] 3′);
viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 539 (5′ [mUs][fGs][fA][mG][fA][mA][fC][mU][mU][fG][mU][mC][mC][fU][mU][fA][mA][mC][mG][mGs][mUs][mG] 3′);
ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 540 (5′ [mUs][fAs][fG][mA][fA][mC][fU][mU][mG][fU][mC][mC][mU][fU][mA][fA][mC][mG][mG][mUs][mGs][mC] 3′);
x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 541 (5′ [mUs][fAs][fC][mU][fC][mA][fG][mA][mG][fA][mA][mC][mU][fU][mG][fU][mC][mC][mU][mUs][mAs][mA] 3′);
xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 542 (5′ [mUs][fUs][fG][mA][fG][mA][fA][mU][mA][fC][mU][mG][mU][fC][mC][fC][mU][mU][mU][mUs][mAs][mA] 3′); or
xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 543 (5′ [mUs][fGs][fA][mG][fA][mG][fC][mA][mC][fU][mG][mA][mG][fA][mA][fU][mA][mC][mU][mGs][mUs][mC] 3′), wherein “m” is a 2′-O-methyl modified nucleotide, “f” is a 2′-F modified nucleotide, “s” is a phosphorothioate internucleotide linkage.
44 . The isolated oligonucleotide of claim 42 , wherein the sense strand comprises any one of:
i) a sense strand of nucleic acid sequence according to SEQ ID NO: 544 (5′ [mGs][mGs][mG][mU][mA][fC][mU][fC][fC][fU][fU][mG][mU][mU][mG][mU][mU][mGs][m Cs][mA][Glb][Glb][Glb] 3′);
ii) a sense strand of nucleic acid sequence according to SEQ ID NO: 545 (5′ [mGs][mGs][mG][mU][mA][fC][mU][fC][fC][fU][fU][mG][mU][mU][mG][mU][mU][mGs][m Cs][mA][Glb][Glb][Glb] 3′);
iii) a sense strand of nucleic acid sequence according to SEQ ID NO: 546 (5′ [mGs][mAs][mC][mA][mA][fG][mU][fU][fC][fU][fC][mU][mG][mA][mG][mU][mU][mCs][m Us][mA][Glb][Glb][Glb] 3′);
iv) a sense strand of nucleic acid sequence according to SEQ ID NO: 547 (5′ [mAs][mCs][mA][mA][mG][fU][mU][fC][fU][fC][fU][mG][mA][mG][mU][mU][mC][mUs][m Gs][mA][Glb][Glb][Glb] 3′);
v) a sense strand of nucleic acid sequence according to SEQ ID NO: 548 (5′ [mCs][mUs][mU][mA][mA][fA][mA][fG][fG][fG][fA][mC][mA][mG][mU][mA][mU][mUs][m Cs][mA][Glb][Glb][Glb] 3′);
vi) a sense strand of nucleic acid sequence according to SEQ ID NO: 549 (5′ [mAs][mAs][mA][mG][mG][fG][mA][fC][fA][fG][fU][mA][mU][mU][mC][mU][mC][mAs][m Gs][mA][Glb][Glb][Glb] 3′);
vii) a sense strand of nucleic acid sequence according to SEQ ID NO: 550 (5′ [mGs][mGs][mA][mC][mA][fG][mU][fA][fU][fU][fC][mU][mC][mA][mG][mU][mG][mCs][m Us][mA][Glb][Glb][Glb] 3′);
viii) a sense strand of nucleic acid sequence according to SEQ ID NO: 551 (5′ [mCs][mCs][mG][mU][mU][fA][mA][fG][fG][fA][fC][mA][mA][mG][mU][mU][mC][mUs][m Cs][mA][Glb][Glb][Glb] 3′);
ix) a sense strand of nucleic acid sequence according to SEQ ID NO: 552 (5′ [mAs][mCs][mC][mG][mU][fU][mA][fA][fG][fG][fA][mC][mA][mA][mG][mU][mU][mCs][m Us][mA][Glb][Glb][Glb] 3′);
x) a sense strand of nucleic acid sequence according to SEQ ID NO: 553 (5′ [mAs][mAs][mG][mG][mA][fC][mA][fA][fG][fU][fU][mC][mU][mC][mU][mG][mA][mGs][m Us][mA][Glb][Glb][Glb] 3′);
xi) a sense strand of nucleic acid sequence according to SEQ ID NO: 554 (5′ [mAs][mAs][mA][mA][mG][fG][mG][fA][fC][fA][fG][mU][mA][mU][mU][mC][mU][mCs][m As][mA][Glb][Glb][Glb] 3′); or
xii) a sense strand of nucleic acid sequence according to SEQ ID NO: 555 (5′ [mCs][mAs][mG][mU][mA][fU][mU][fC][fU][fC][fA][mG][mU][mG][mC][mU][mC][mUs][m Cs][mA][Glb][Glb][Glb] 3′), wherein “m” is a 2′-O-methyl modified nucleotide, “f” is a 2′-F modified nucleotide, “s” is a phosphorothioate internucleotide linkage.
45 . The isolated oligonucleotide of claim 43 , wherein the double stranded region comprises:
i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 532 (5′ [mUs][fGs][fC][mA][fA][mC][fA][mA][mC][fA][mA][mG][mG][fA][mG][fU][mA][mC][mC][mCs][mGs][mG] 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 544 (5′ [mGs][mGs][mG][mU][mA][fC][mU][fC][fC][fU][fU][mG][mU][mU][mG][mU][mU][mGs][m Cs][mA][Glb][Glb][Glb] 3′);
ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 533 (5′ [mUs][fCs][fA][mG][fA][mG][fA][mA][mC][fU][mU][mG][mU][fC][mC][fU][mU][mA][mA][mCs][mGs][mG] 3′) and a sense strand of nucleic acid sequence according to SEQ ID NO: 545 (5′ [mGs][mGs][mG][mU][mA][fC][mU][fC][fC][fU][fU][mG][mU][mU][mG][mU][mU][mGs][m Cs][mA][Glb][Glb][Glb] 3′);
iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 534 (5′ [mUs][fAs][fG][mA][fA][mC][fU][mC][mA][fG][mA][mG][mA][fA][mC][fU][mU][mG][mU][mCs][mCs][mU] 3′) and a sense strand of nucleic acid sequence according to SEQ ID NO: 546 (5′ [mGs][mAs][mC][mA][mA][fG][mU][fU][fC][fU][fC][mU][mG][mA][mG][mU][mU][mCs][m Us][mA][Glb][Glb][Glb] 3′);
iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 535 (5′ [mUs][fCs][fA][mG][fA][mA][fC][mU][mC][fA][mG][mA][mG][fA][mA][fC][mU][mU][mG][mUs][mCs][mC] 3′) and a sense strand of nucleic acid sequence according to SEQ ID NO: 547 (5′ [mAs][mCs][mA][mA][mG][fU][mU][fC][fU][fC][fU][mG][mA][mG][mU][mU][mC][mUs][m Gs][mA][Glb][Glb][Glb] 3′);
v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 536 (5′ [mUs][fGs][fA][mA][fU][mA][fC][mU][mG][fU][mC][mC][mC][fU][mU][fU][mU][mA][mA][mGs][mCs][mA] 3′) and a sense strand of nucleic acid sequence according to SEQ ID NO: 548 (5′ [mCs][mUs][mU][mA][mA][fA][mA][fG][fG][fG][fA][mC][mA][mG][mU][mA][mU][mUs][m Cs][mA][Glb][Glb][Glb] 3′);
vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 537 (5′ [mUs][fCs][fU][mG][fA][mG][fA][mA][mU][fA][mC][mU][mG][fU][mC][fC][mC][mU][mU][mUs][mUs][mA] 3′) and a sense strand of nucleic acid sequence according to SEQ ID NO: 549 (5′ [mAs][mAs][mA][mG][mG][fG][mA][fC][fA][fG][fU][mA][mU][mU][mC][mU][mC][mAs][m Gs][mA][Glb][Glb][Glb] 3′);
vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 538 (5′ [mUs][fAs][fG][mC][fA][mC][fU][mG][mA][fG][mA][mA][mU][fA][mC][fU][mG][mU][mC][mCs][mCs][mU] 3′) and a sense strand of nucleic acid sequence according to SEQ ID NO: 550 (5′ [mGs][mGs][mA][mC][mA][fG][mU][fA][fU][fU][fC][mU][mC][mA][mG][mU][mG][mCs][m Us][mA][Glb][Glb][Glb] 3′);
viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 539 (5′ [mUs][fGs][fA][mG][fA][mA][fC][mU][mU][fG][mU][mC][mC][fU][mU][fA][mA][mC][mG][mGs][mUs][mG] 3′) and a sense strand of nucleic acid sequence according to SEQ ID NO: 551 (5′ [mCs][mCs][mG][mU][mU][fA][mA][fG][fG][fA][fC][mA][mA][mG][mU][mU][mC][mUs][m Cs][mA][Glb][Glb][Glb] 3′);
ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 540 (5′ [mUs][fAs][fG][mA][fA][mC][fU][mU][mG][fU][mC][mC][mU][fU][mA][fA][mC][mG][mG][mUs][mGs][mC] 3′) and a sense strand of nucleic acid sequence according to SEQ ID NO: 552 (5′ [mAs][mCs][mC][mG][mU][fU][mA][fA][fG][fG][fA][mC][mA][mA][mG][mU][mU][mCs][m Us][mA][Glb][Glb][Glb] 3′);
x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 541 (5′ [mUs][fAs][fC][mU][fC][mA][fG][mA][mG][fA][mA][mC][mU][fU][mG][fU][mC][mC][mU][mUs][mAs][mA] 3′) and a sense strand of nucleic acid sequence according to SEQ ID NO: 553 (5′ [mAs][mAs][mG][mG][mA][fC][mA][fA][fG][fU][fU][mC][mU][mC][mU][mG][mA][mGs][m Us][mA][Glb][Glb][Glb] 3′);
xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 542 (5′ [mUs][fUs][fG][mA][fG][mA][fA][mU][mA][fC][mU][mG][mU][fC][mC][fC][mU][mU][mU][mUs][mAs][mA] 3′) and a sense strand of nucleic acid sequence according to SEQ ID NO: 554 (5′ [mAs][mAs][mA][mA][mG][fG][mG][fA][fC][fA][fG][mU][mA][mU][mU][mC][mU][mCs][m As][mA][Glb][Glb][Glb] 3′); or
xii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 543 (5′ [mUs][fGs][fA][mG][fA][mG][fC][mA][mC][fU][mG][mA][mG][fA][mA][fU][mA][mC][mU][mGs][mUs][mC] 3′) and a sense strand of nucleic acid sequence according to SEQ ID NO: 555 (5′ [mCs][mAs][mG][mU][mA][fU][mU][fC][fU][fC][fA][mG][mU][mG][mC][mU][mC][mUs][m Cs][mA][Glb][Glb][Glb] 3′).
46 . A vector encoding the isolated oligonucleotide of claim 1 .
47 . A delivery system comprising the isolated oligonucleotide of claim 1 .
48 . A pharmaceutical composition comprising at least one isolated oligonucleotide of claim 1 , and a pharmaceutically acceptable carrier, diluent or excipient.
49 . (canceled)
50 . A method of inhibiting or downregulating the expression or level of ApoC3 or treating or preventing a disease or disorder associated with aberrant or increased expression or activity of ApoC3 or a disease or disorder where ApoC3 plays a role in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of at least one isolated oligonucleotide of claim 1 .
51 . (canceled)
52 . The isolated oligonucleotide of claim 30 , wherein the antisense strand comprises nucleotides modified with 2′-F modification, and nucleotides modified with 2′-O-methyl modification, according to the formula:
3′(M) 0 (F) 0 (M) 6 (F) 1 (M) 1 (F) 1 (M) 3 (F) 1 (M) 2 (F) 1 (M) 1 (F) i (M) 1 (F) 2 (M) 1 5′.
53 . The isolated oligonucleotide of claim 30 , wherein the sense strand comprises nucleotides modified with 2′-F modification, and nucleotides modified with 2′-O-methyl modification, according to the formula:
5′(M) 0 (F) 0 (M) 5 (F) 1 (M) 1 (F) 4 (M) 9 3′.
54 . A vector encoding the isolated oligonucleotide of claim 30 .
55 . A delivery system comprising the isolated oligonucleotide of claim 30 .
56 . A pharmaceutical composition comprising at least one isolated oligonucleotide of claim 30 , and a pharmaceutically acceptable carrier, diluent or excipient.
57 . A method of inhibiting or downregulating the expression or level of ApoC3 or treating or preventing a disease or disorder associated with aberrant or increased expression or activity of ApoC3 or a disease or disorder where ApoC3 plays a role in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of at least one isolated oligonucleotide of claim 30 .