SMALL INTERFERING RNA TARGETING CFB AND USES THEREOF
This disclosure relates to isolated oligonucleotides comprising duplex regions targeting human CFB mRNA, and delivery systems, kits and compositions comprising the same, and methods of using the same for inhibiting or downregulating CFB gene expression.
1 . An isolated oligonucleotide comprising an antisense strand and a sense strand, selected from:
i) an isolated oligonucleotide comprising:
an antisense strand of nucleic acid sequence according to SEQ ID NO: 24 (5′ UGUCAUAAAAUUCAGGAAUUCC 3′), and
a sense strand of nucleic acid sequence according to SEQ ID NO: 58 (5′ AAUUCCUGAAUUUUAUGACA 3′);
ii) an isolated oligonucleotide comprising:
an antisense strand of nucleic acid sequence according to SEQ ID NO: 22 (5′ UUAAAAUUCAGGAAUUCCUGCU 3′), and
a sense strand of nucleic acid sequence according to SEQ ID NO: 56 (5′ CAGGAAUUCCUGAAUUUUAA 3′); and
iii) an isolated oligonucleotide comprising:
an antisense strand of nucleic acid sequence according to SEQ ID NO: 15 (5′ UAACACAUGUUGCUCAUUGUCU 3′), and
a sense strand of nucleic acid sequence according to SEQ ID NO: 49 (5′ ACAAUGAGCAACAUGUGUUA 3′).
2 . The isolated oligonucleotide of claim 1 , comprising:
an antisense strand of nucleic acid sequence according to SEQ ID NO: 24 (5′ UGUCAUAAAAUUCAGGAAUUCC 3′), and
a sense strand of nucleic acid sequence according to SEQ ID NO: 58 (5′ AAUUCCUGAAUUUUAUGACA 3′).
3 . The isolated oligonucleotide of claim 1 , comprising:
an antisense strand of nucleic acid sequence according to SEQ ID NO: 22 (5′ UUAAAAUUCAGGAAUUCCUGCU 3′), and
a sense strand of nucleic acid sequence according to SEQ ID NO: 56 (5′ CAGGAAUUCCUGAAUUUUAA 3′).
4 . The isolated oligonucleotide of claim 1 , comprising:
an antisense strand of nucleic acid sequence according to SEQ ID NO: 15 (5′ UAACACAUGUUGCUCAUUGUCU 3′), and
a sense strand of nucleic acid sequence according to SEQ ID NO: 49 (5′ ACAAUGAGCAACAUGUGUUA 3′).
5 . The isolated oligonucleotide of claim 1 , wherein the antisense strand or the sense strand or both comprise one or more modified nucleotide(s).
6 . The isolated oligonucleotide of claim 1 , wherein the antisense strand comprises a mono methyl protected phosphate mimic (5′-MeEP).
7 . The isolated oligonucleotide of claim 1 , wherein in the sense strand or the antisense strand or both, a terminal or internal nucleotide is linked to a targeting ligand.
8 . The isolated oligonucleotide of claim 7 , wherein the targeting ligand comprises at least one GalNAc G1b moiety of the following structure:
wherein
indicates the point of attachment to the isolated oligonucleotide or the other G1b moieties.
9 . The isolated oligonucleotide of claim 1 , wherein the antisense strand comprises nucleotides modified with 2′-F modification, and nucleotides modified with 2′-O-methyl modification, according to the formula:
3′(M) 0 (F) 0 (M) 6 (F) 1 (M) 1 (F) 1 (M) 3 (F) 1 (M) 2 (F) 1 (M) 1 (F) 1 (M) 1 (F) 2 (M) 1 5′,
wherein “M” is a 2′-O-methyl modified nucleotide, and “F” is a 2′-F modified nucleotide.
10 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises nucleotides modified with 2′-F modification, and nucleotides modified with 2′-O-methyl modification, according to the formula:
5′(M) 0 (F) 0 (M) 5 (F) 1 (M) 1 (F) 4 (M) 9 3′,
wherein “M” is a 2′-O-methyl modified nucleotide, and “F” is a 2′-F modified nucleotide.
11 . The isolated oligonucleotide of claim 1 , wherein:
the antisense strand comprises nucleotides modified with 2′-F modification, and nucleotides modified with 2′-O-methyl modification, according to the formula:
3′(M) 0 (F) 0 (M) 6 (F) 1 (M) 1 (F) 1 (M) 3 (F) 1 (M) 2 (F) 1 (M) 1 (F) 1 (M) 1 (F) 2 (M) 1 5′; and
the sense strand comprises nucleotides modified with 2′-F modification, and nucleotides modified with 2′-O-methyl modification, according to the formula:
5′(M) 0 (F) 0 (M) 5 (F) 1 (M) 1 (F) 4 (M) 9 3′,
wherein “M” is a 2′-O-methyl modified nucleotide, and “F” is a 2′-F modified nucleotide.
12 . The isolated oligonucleotide of claim 1 , wherein the antisense strand is selected from:
i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 377 (5′ [mUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC] 3);
ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 378 (5′ [mUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU] 3′); and
iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 390 (5′ [mUs][fAs][fA][mC][fA][mC][fA][mU][mG][fU][mU][mG][mC][fU][mC][fA][mU][mU][mG][mUs][mCs][mU] 3′),
wherein “m” is a 2′-O-methyl modification, “f” is a 2′-F modification, and “s” is a phosphorothioate internucleotide linkage.
13 . The isolated oligonucleotide of claim 1 , wherein the sense strand is selected from:
i) a sense strand of nucleic acid sequence according to SEQ ID NO: 381 (5′ [mAs][mAs][mU][mU][mC][fC][mU][fG][fA][fA][fU][mU][mU][mU][mA][mU][mG][mAs][m Cs][mA][G1b][G1b][G1b] 3′);
ii) a sense strand of nucleic acid sequence according to SEQ ID NO: 382 (5′ [mCs][mAs][mG][mG][mA][fA][mU][fU][fC][fC][fU][mG][mA][mA][mU][mU][mU][mUs][m As][mA][G1b][G1b][G1b] 3′); and
iii) a sense strand of nucleic acid sequence according to SEQ ID NO: 385 (5′ [mAs][mCs][mA][mA][mU][fG][mA][fG][fC][fA][fA][mC][mA][mU][mG][mU][mG][mUs][m Us][mA][G1b][G1b][G1b] 3′),
wherein “m” is a 2′-O-methyl modification, “f” is a 2′-F modification, “s” is a phosphorothioate internucleotide linkage, and “G1b” is a GalNac G1b moiety of the following structure:
wherein
indicates the point of attachment to the isolated oligonucleotide or the other G1b moieties.
14 . The isolated oligonucleotide of claim 1 , selected from:
i) an isolated oligonucleotide comprising:
an antisense strand of nucleic acid sequence according to SEQ ID NO: 377 (5′ [mUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC] 3′), and
a sense strand of nucleic acid sequence according to SEQ ID NO: 381 (5′ [mAs][mAs][mU][mU][mC][fC][mU][fG][fA][fA][fU][mU][mU][mU][mA][mU][mG][mAs][m Cs][mA][G1b][G1b][G1b] 3′);
ii) an isolated oligonucleotide comprising:
an antisense strand of nucleic acid sequence according to SEQ ID NO: 378 (5′ [mUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU] 3′), and
a sense strand of nucleic acid sequence according to SEQ ID NO: 382 (5′ [mCs][mAs][mG][mG][mA][fA][mU][fU][fC][fC][fU][mG][mA][mA][mU][mU][mU][mUs][m As][mA][G1b][G1b][G1b] 3′); and
iii) an isolated oligonucleotide comprising:
an antisense strand of nucleic acid sequence according to SEQ ID NO: 390 (5′ [mUs][fAs][fA][mC][fA][mC][fA][mU][mG][fU][mU][mG][mC][fU][mC][fA][mU][mU][mG] [mUs][mCs][mU] 3′), and
a sense strand of nucleic acid sequence according to SEQ ID NO: 385 (5′ [mAs][mCs][mA][mA][mU][fG][mA][fG][fC][fA][fA][mC][mA][mU][mG][mU][mG][mUs][m Us][mA][G1b][G1b][G1b] 3′),
wherein “m” is a 2′-O-methyl modification, “f” is a 2′-F modification, “s” is a phosphorothioate internucleotide linkage, and “G1b” is a GalNac G1b moiety of the following structure:
wherein
indicates the point of attachment to the isolated oligonucleotide or the other G1b moiety.
15 . The isolated oligonucleotide of claim 14 , comprising:
an antisense strand of nucleic acid sequence according to SEQ ID NO: 377 (5′ [mUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC] 3′), and
a sense strand of nucleic acid sequence according to SEQ ID NO: 381 (5′ [mAs][mAs][mU][mU][mC][fC][mU][fG][fA][fA][fU][mU][mU][mU][mA][mU][mG][mAs][m Cs][mA][G1b][G1b][G1b] 3′).
16 . The isolated oligonucleotide of claim 14 , comprising:
an antisense strand of nucleic acid sequence according to SEQ ID NO: 378 (5′ [mUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU] 3′), and
a sense strand of nucleic acid sequence according to SEQ ID NO: 382 (5′ [mCs][mAs][mG][mG][mA][fA][mU][fU][fC][fC][fU][mG][mA][mA][mU][mU][mU][mUs][m As][mA][G1b][G1b][G1b] 3′).
17 . The isolated oligonucleotide of claim 14 , comprising:
an antisense strand of nucleic acid sequence according to SEQ ID NO: 390 (5′ [mUs][fAs][fA][mC][fA][mC][fA][mU][mG][fU][mU][mG][mC][fU][mC][fA][mU][mU][mG] [mUs][mCs][mU] 3′), and
a sense strand of nucleic acid sequence according to SEQ ID NO: 385 (5′ [mAs][mCs][mA][mA][mU][fG][mA][fG][fC][fA][fA][mC][mA][mU][mG][mU][mG][mUs][m Us][mA][G1b][G1b][G1b] 3′).
18 . The isolated oligonucleotide of claim 1 , selected from:
i) an isolated oligonucleotide comprising:
an antisense strand of nucleic acid sequence according to SEQ ID NO: 370 (5′ [MeEPmUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC] 3′), and
a sense strand of nucleic acid sequence according to SEQ ID NO: 381 (5′ [mAs][mAs][mU][mU][mC][fC][mU][fG][fA][fA][fU][mU][mU][mU][mA][mU][mG][mAs][m Cs][mA][G1b][G1b][G1b] 3′);
ii) an isolated oligonucleotide comprising:
an antisense strand of nucleic acid sequence according to SEQ ID NO: 371 (5′ [MeEPmUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU] 3′), and
a sense strand of nucleic acid sequence according to SEQ ID NO: 382 (5′ [mCs][mAs][mG][mG][mA][fA][mU][fU][fC][fC][fU][mG][mA][mA][mU][mU][mU][mUs][m As][mA][G1b][G1b][G1b] 3′); and
iii) an isolated oligonucleotide comprising:
an antisense strand of nucleic acid sequence according to SEQ ID NO: 374 (5′ [MeEPmUs][fAs][fA][mC][fA][mC][fA][mU][mG][fU][mU][mG][mC][fU][mC][fA][mU][mU][mG][mUs][mCs][mU] 3′), and
a sense strand of nucleic acid sequence according to SEQ ID NO: 385 (5′ [mAs][mCs][mA][mA][mU][fG][mA][fG][fC][fA][fA][mC][mA][mU][mG][mU][mG][mUs][m Us][mA][G1b][G1b][G1b] 3′),
wherein “m” is a 2′-O-methyl modification, “f” is a 2′-F modification, “s” is a phosphorothioate internucleotide linkage, “MeEP” is a mono methyl protected phosphate mimic, and “G1b” is a GalNac G1b moiety of the following structure:
wherein
indicates the point of attachment to the isolated oligonucleotide or the other G1b moiety.
19 . The isolated oligonucleotide of claim 18 , comprising:
an antisense strand of nucleic acid sequence according to SEQ ID NO: 370 (5′ [MeEPmUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC] 3′), and
a sense strand of nucleic acid sequence according to SEQ ID NO: 381 (5′ [mAs][mAs][mU][mU][mC][fC][mU][fG][fA][fA][fU][mU][mU][mU][mA][mU][mG][mAs][m Cs][mA][G1b][G1b][G1b] 3′).
20 . The isolated oligonucleotide of claim 18 , comprising:
an antisense strand of nucleic acid sequence according to SEQ ID NO: 371 (5′ [MeEPmUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU] 3′), and
a sense strand of nucleic acid sequence according to SEQ ID NO: 382 (5′ [mCs][mAs][mG][mG][mA][fA][mU][fU][fC][fC][fU][mG][mA][mA][mU][mU][mU][mUs][m As][mA][G1b][G1b][G1b] 3′).
21 . The isolated oligonucleotide of claim 18 , comprising:
an antisense strand of nucleic acid sequence according to SEQ ID NO: 374 (5′ [MeEPmUs][fAs][fA][mC][fA][mC][fA][mU][mG][fU][mU][mG][mC][fU][mC][fA][mU][mU][mG][mUs][mCs][mU] 3′), and
a sense strand of nucleic acid sequence according to SEQ ID NO: 385 (5′ [mAs][mCs][mA][mA][mU][fG][mA][fG][fC][fA][fA][mC][mA][mU][mG][mU][mG][mUs][m Us][mA][G1b][G1b][G1b] 3′).
22 . A vector encoding the isolated oligonucleotide of claim 1 .
23 . A delivery system comprising the isolated oligonucleotide of claim 1 .
24 . A pharmaceutical composition comprising at least one isolated oligonucleotide of claim 1 , and a pharmaceutically acceptable carrier, diluent or excipient.
25 . A method of inhibiting or downregulating the expression or level of complement factor B (CFB) in a subject in need thereof, comprising administering to the subject an effective amount of at least one isolated oligonucleotide of claim 1 .
26 . A method of treating or preventing a disease or disorder associated with aberrant or increased expression or activity of complement factor B (CFB) or a disease or disorder where CFB plays a role in a subject in need thereof, comprising administering to the subject an effective amount of at least one isolated oligonucleotide of claim 1 .