DOUBLE STRANDED RNA TARGETING PROPROTEIN CONVERTASE SUBTILISIN KEXIN 9 (PCSK9) AND METHODS OF USE THEREOF

1 . An isolated oligonucleotide comprising a sense strand and an antisense strand, wherein:

the sense strand comprises a nucleotide sequence that is substantially identical to a region between the nucleotide positions 3543 to 3596, from the 5′ end of a Proprotein convertase subtilisin/kexin type 9 (PCSK9) mRNA sequence according to SEQ ID NO: 1,

and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double stranded region.

2 .- 3 . (canceled)

4 . The isolated oligonucleotide of claim 1 , wherein the antisense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 2-7, 28 or 29.

5 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 8-13, 30 or 31.

6 . The isolated oligonucleotide of claim 1 , wherein the double stranded region comprises:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 2 (5′ UUAUCUUCAAGUUACAAAAGCA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 8 (5′ CUUUUGUAACUUGAAGAUAA 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 3 (5′ UGAAUAAAUAUCUUCAAGUUAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 9 (5′ AACUUGAAGAUAUUUAUUCA 3′);

iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 6 (5′ UUUAAUAAAAAUGCUACAAAAC 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 12 (5′ UUUGUAGCAUUUUUAUUAAA 3′);

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 7 (5′ UUAUUAAUAAAAAUGCUACAAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 13 (5′ UGUAGCAUUUUUAUUAAUAA 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 28 (5′ UAUGCUACAAAACCCAGAAUAA 3′), and a sense strand of nucleic acid sequence according to SEQ ID NO: 30 (5′ AUUCUGGGUUUUGUAGCAUA 3′),

i) an antisense strand of nucleic acid sequence according to SEO ID NO: 4 (5′ UAAAAAUGCUACAAAACCCAGA 3′), and a sense strand of nucleic acid sequence according to SEO ID NO: 10 (5′ UGGGUUUUGUAGCAUUUUUA 3′);

ii) an antisense strand of nucleic acid sequence according to SEO ID NO: 5 (5′ UAAUAAAAAUGCUACAAAACCC 3′), and a sense strand of nucleic acid sequence according to SEO ID NO: 11 (5′ GUUUUUGUAGCAUUUUUAUUA 3′); or

iii) an antisense strand of nucleic acid sequence according to SEO ID NO: 29 (5′ UUAAUAAAAAUGCUACAAAACC 3′), and a sense strand of nucleic acid sequence according to SEO ID NO: 31 (5′ UUUUGUAGCAUUUUUAUUAA 3′).

7 . (canceled)

8 . The isolated oligonucleotide of claim 1 , wherein the sense strand or the antisense strand or both comprise one or more modified nucleotide(s).

9 . The isolated oligonucleotide of claim 8 , wherein the antisense strand comprises a mono methyl protected phosphate mimic (5′-MeEP) or wherein the antisense strand comprises a phosphate mimic linked to a 5′-terminal uracil, wherein the phosphate mimic is selected from:

10 . (canceled)

11 . The isolated oligonucleotide of claim 1 , wherein in the sense strand or the antisense strand or both, a terminal or internal nucleotide is linked to a targeting ligand.

12 . The isolated oligonucleotide of claim 11 , wherein the targeting ligand is attached to the 3′ end (e.g., 3′ terminal position) of the sense strand.

13 . The isolated oligonucleotide of claim 11 , wherein the targeting ligand comprises a GalNAc.

14 . (canceled)

15 . The isolated oligonucleotide of claim 1 , wherein the antisense strand comprises nucleotides modified with 2′-F modification, and nucleotides modified with 2′-O-methyl modification, according to the formula:

3′(M) 0 (F) 0 (M)(F) 1 (M) 1 (F) 1 (M) 3 (F) 1 (M) 2 (F) 1 (M) 1 (F) 1 (M) 1 (F) 2 (M) 1 5′.

16 . The isolated oligonucleotide of claim 1 , wherein the sense strand comprises nucleotides modified with 2′-F modification, and nucleotides modified with 2′-O-methyl modification, according to the formula:

5′(M) 0 (F) 0 (M) 5 (F) 1 (M) 1 (F) 4 (M) 9 3′.

17 . The isolated oligonucleotide of claim 15 , wherein the antisense strand comprises any one of:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 17 (5′ [MeEPmUs][fUs][fA][mU][fC][mU][fU][mC][mA][fA][mG][mU][mU][fA][mC][fA][mA][mA][mA][mGs][mCs][mA] 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 19 (5′ [MeEPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3′);

iii) i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 21 (5′ [MeEPmUs][fAs][fA][mA][fA][mA][fU][mG][mC][fU][mA][mC][mA][fA][mA][fA][mC][mC][mC][mAs][mGs][mA] 3′);

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 23 (5′ [MeEPmUs][fAs][fA][mU][fA][mA][fA][mA][mA][fU][mG][mC][mU][fA][mC][fA][mA][mA][mA][mCs][mCs][mC] 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 25 (5′ [MeEPmUs][fUs][fU][mA][fA][mU][fA][mA][mA][fA][mA][mU][mG][fC][mU][fA][mC][mA][mA][mAs][mAs][mC] 3′);

vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 27 (5′ [MeEPmUs][fUs][fA][mU][fU][mA][fA][mU][mA][fA][mA][mA][mA][fU][mG][fC][mU][mA][mC][mAs][mAs][mA] 3′);

vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 33 (5′ [MeEPmUs][fAs][fU][mG][fC][mU][fA][mC][mA][fA][mA][mA][mC][fC][mC][fA][mG][mA][mA][mUs][mAs][mA] 3′);

viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 35 (5′ [MeEPmUs][fUs][fA][mA][fU][mA][fA][mA][mA][fA][mU][mG][mC][fU][mA][fC][mA][mA][mA][mAs][mCs][mC] 3′);

ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 53 (5′ [EPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3′); or

x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 54 (5′ [C-EPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3′),

wherein “m” is a 2′-O-methyl modified nucleotide, “f” is a 2′-F modified nucleotide, “s” is a phosphorothioate internucleotide linkage, “MeEPmU” is

and “C-EPmU” is

18 . The isolated oligonucleotide of claim 16 , wherein the sense strand comprises any one of:

i) a sense strand of nucleic acid sequence according to SEQ ID NO: 16 (5′ [mCs][mUs][mU][mU][mU][fG][mU][fA][fA][fC][fU][mU][mG][mA][mA][mG][mA][mUs][mAs][mA][G1b][G1b][G1b] 3′);

ii) a sense strand of nucleic acid sequence according to SEQ ID NO: 18 (5′ [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mUs][mCs][mA][G1b][G1b][G1b] 3′);

iii) a sense strand of nucleic acid sequence according to SEQ ID NO: 20 (5′ [mUs][mGs][mG][mG][mU][fU][mU][fU][fG][fU][fA][mG][mC][mA][mU][mU][mU][mUs][mUs][mA][G1b][G1b][G1b] 3′);

iv) a sense strand of nucleic acid sequence according to SEQ ID NO: 22 (5′ [mGs][mUs][mU][mU][mU][fG][mU][fA][fG][fC][fA][mU][mU][mU][mU][mU][mA][mUs][mUs][mA][G1b][G1b][G1b] 3′);

v) a sense strand of nucleic acid sequence according to SEQ ID NO: 24 (5′ [mUs][mUs][mU][mG][mU][fA][mG][fC][fA][fU][fU][mU][mU][mU][mA][mU][mU][mAs][mAs][mA][G1b][G1b][G1b] 3′);

vi) a sense strand of nucleic acid sequence according to SEQ ID NO: 26 (5′ [mUs][mGs][mU][mA][mG][fC][mA][fU][fU][fU][fU][mU][mA][mU][mU][mA][mA][mUs][mAs][mA][G1b][G1b][G1b] 3′);

vii) a sense strand of nucleic acid sequence according to SEQ ID NO: 32 (5′ [mAs][mUs][mU][mC][mU][fG][mG][fG][fU][fU][fU][mU][mG][mU][mA][mG][mC][mAs][mUs][mA][G1b][G1b][G1b] 3′);

viii) a sense strand of nucleic acid sequence according to SEQ ID NO: 34 (5′ [mUs][mUs][mU][mU][mG][fU][mA][fG][fC][fA][fU][mU][mU][mU][mU][mA][mU][mUs][mAs][mA][G1b][G1b][G1b] 3′); or

ix) a sense strand of nucleic acid sequence according to SEQ ID NO: 52 (5′ [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mU][mC][mA][G1b][G1b][G1b] 3′),

wherein “m” is a 2′-O-methyl modified nucleotide, “f” is a 2′-F modified nucleotide, “s” is a phosphorothioate internucleotide linkage, and “G1b” is a GalNac G1b moiety.

19 . The isolated oligonucleotide of claim 17 , wherein the double stranded region comprises:

i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 17 (5′ [MeEPmUs][fUs][fA][mU][fC][mU][fU][mC][mA][fA][mG][mU][mU][fA][mC][fA][mA][mA][mA][mGs][mCs][mA] 3′), and

a sense strand of nucleic acid sequence according to SEQ ID NO: 16 (5′ [mCs][mUs][mU][mU][mU][fG][mU][fA][fA][fC][fU][mU][mG][mA][mA][mG][mA][mUs][mAs][mA][G1b][G1b][G1b] 3′);

ii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 19 (5′ [MeEPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3′), and

a sense strand of nucleic acid sequence according to SEQ ID NO: 18 (5′ [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mUs][mCs][mA][G1b][G1b][G1b] 3′);

iii) i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 21 (5′ [MeEPmUs][fAs][fA][mA][fA][mA][fU][mG][mC][fU][mA][mC][mA][fA][mA][fA][mC][mC][mC][mAs][mGs][mA] 3′), and

a sense strand of nucleic acid sequence according to SEQ ID NO: 20 (5′ [mUs][mGs][mG][mG][mU][fU][mU][fU][fG][fU][fA][mG][mC][mA][mU][mU][mU][mUs][mUs][mA][G1b][G1b][G1b] 3′);

iv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 23 (5′ [MeEPmUs][fAs][fA][mU][fA][mA][fA][mA][mA][fU][mG][mC][mU][fA][mC][fA][mA][mA][mA][mCs][mCs][mC] 3′), and

a sense strand of nucleic acid sequence according to SEQ ID NO: 22 (5′ [mGs][mUs][mU][mU][mU][fG][mU][fA][fG][fC][fA][mU][mU][mU][mU][mU][mA][mUs][mUs][mA][G1b][G1b][G1b] 3′);

v) an antisense strand of nucleic acid sequence according to SEQ ID NO: 25 (5′ [MeEPmUs][fUs][fU][mA][fA][mU][fA][mA][mA][fA][mA][mU][mG][fC][mU][fA][mC][mA][mA][mAs][mAs][mC] 3′), and

a sense strand of nucleic acid sequence according to SEQ ID NO: 24 (5′ [mUs][mUs][mU][mG][mU][fA][mG][fC][fA][fU][fU][mU][mU][mU][mA][mU][mU][mAs][mAs][mA][G1b][G1b][G1b] 3′);

vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 27 (5′ [MeEPmUs][fUs][fA][mU][fU][mA][fA][mU][mA][fA][mA][mA][mA][fU][mG][fC][mU][mA][mC][mAs][mAs][mA] 3′), and

a sense strand of nucleic acid sequence according to SEQ ID NO: 26 (5′ [mUs][mGs][mU][mA][mG][fC][mA][fU][fU][fU][fU][mU][mA][mU][mU][mA][mA][mUs][mAs][mA][G1b][G1b][G1b] 3′);

vii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 33 (5′ [MeEPmUs][fAs][fU][mG][fC][mU][fA][mC][mA][fA][mA][mA][mC][fC][mC][fA][mG][mA][mA][mUs][mAs][mA] 3′), and

a sense strand of nucleic acid sequence according to SEQ ID NO: 32 (5′ [mAs][mUs][mU][mC][mU][fG][mG][fG][fU][fU][fU][mU][mG][mU][mA][mG][mC][mAs][mUs][mA][G1b][G1b][G1b] 3′);

viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 35 (5′ [MeEPmUs][fUs][fA][mA][fU][mA][fA][mA][mA][fA][mU][mG][mC][fU][mA][fC][mA][mA][mA][mAs][mCs][mC] 3′), and

a sense strand of nucleic acid sequence according to SEQ ID NO: 34 (5′ [mUs][mUs][mU][mU][mG][fU][mA][fG][fC][fA][fU][mU][mU][mU][mU][mA][mU][mUs][mAs][mA][G1b][G1b][G1b] 3′);

ix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 19 (5′ [MeEPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3′), and

a sense strand of nucleic acid sequence according to SEQ ID NO: 52 (5′ [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mU][mC][mA][G1b][G1b][G1b] 3′);

x) an antisense strand of nucleic acid sequence according to SEQ ID NO: 53 (5′ [EPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3′), and

a sense strand of nucleic acid sequence according to SEQ ID NO: 18 (5′ [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mUs][mCs][mA][G1b][G1b][G1b] 3′); or

xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 54 (5′ [C-EPmUs][fGs][fA][mA][fU][mA][fA][mA][mU][fA][mU][mC][mU][fU][mC][fA][mA][mG][mU][mUs][mAs][mC] 3′), and

a sense strand of nucleic acid sequence according to SEQ ID NO: 18 (5′ [mAs][mAs][mC][mU][mU][fG][mA][fA][fG][fA][fU][mA][mU][mU][mU][mA][mU][mUs][mCs][mA][G1b][G1b][G1b] 3′),

wherein “m” is a 2′-O-methyl modified nucleotide, “f” is a 2′-F modified nucleotide, “s” is a phosphorothioate internucleotide linkage, “G1b” is a GalNac G1b moiety, “MeEPmU” is

and “C-EPmU” is

20 . A vector encoding the isolated oligonucleotide of claim 1 .

21 . (canceled)

22 . A delivery system comprising the isolated oligonucleotide of claim 1 .

23 . A pharmaceutical composition comprising the isolated oligonucleotide of claim 1 , and a pharmaceutically acceptable carrier, diluent or excipient.

24 . (canceled)

25 . A method of inhibiting or downregulating the expression or level of PCSK9 or treating or preventing a disease or disorder associated with aberrant or increased expression or activity of PCSK9 or a disease or disorder where PCSK9 plays a role in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of the isolated oligonucleotide of claim 1 .

26 .- 29 . (canceled)