CELL-FREE EXPRESSION VECTORS AND METHODS FOR IMPROVED PROTEIN PRODUCTION
The present disclosure relates to improved methods, compositions, and kits for cell-free expression of proteins in vitro.
1 . A method of creating or modifying a cell-free expression vector, the method comprising:
(a) obtaining a cell-free expression vector comprising
(i) an origin of replication (ori),
(ii) a nucleic acid sequence encoding a protein or RNA,
(iii) a promoter arranged to drive expression of the protein or RNA, and
(iv) one or more selectable markers; and
(b) inserting into the cell-free expression vector an insulating terminator sequence at a location that is between 0 and 10,000 nucleotides in a 5′ direction from the promoter.
2 . A method of performing protein or RNA synthesis in vitro, the method comprising synthesizing protein or RNA in vitro using a cell-free expression vector, wherein the cell-free expression vector comprises:
(i) an origin of replication (ori);
(ii) a nucleic acid encoding protein or RNA to be synthesized;
(iii) a promoter arranged to drive expression of the protein or RNA;
(iv) an insulating terminator sequence located between 0 and 10,000 nucleotides in a 5′ direction from the promoter; and
(iv) one or more selectable markers.
3 . The method of claim 1 or claim 2 , wherein the method avoids or reduces read-through of toxic product proteins during plasmid generation, while avoiding or decreasing a reduction in protein synthesis of the protein during cell-free protein synthesis.
4 . The method of any one of claims 1-3 , wherein the method avoids or reduces production of toxic RNA products.
5 . The method of any one of claims 1-4 , wherein the cell-free expression vector with the insulating terminator enables synthesis of the protein or RNA at a higher yield, with a higher growth rate, and/or with fewer sequence mutations than synthesis of the protein or RNA using a cell-free expression vector without an insulating terminator.
6 . The method of any one of claims 1-4 , wherein the cell-free expression vector with the insulating terminator enables synthesis of the protein or RNA at a higher level compared to a level of synthesis of the protein or RNA using a cell-free expression vector without an insulating terminator.
7 . The method of any one of claims 1-6 , wherein the cell-free expression vector contains a gene for a protein or RNA that inhibits or slows cellular replication in cells containing the cell-free expression vector.
8 . The method of any one of claims 1-2 wherein the cell-free expression vector contains a gene for a protein or RNA that reduces plasmid yield from the cells containing the cell-free expression vector.
9 . The method of any one of claims 1-8 , wherein the insulating terminator sequence is rnpB-T1 (SEQ ID NO: 820), rrnB T1 (SEQ ID NO: 14), L3S2P21 (SEQ ID NO: 318), or L3S2P56 (SEQ ID NO: 319).
10 . The method of claim 9 , wherein the insulating terminator sequence is rnpB-T1 (SEQ ID NO: 820).
11 . The method of any one of claims 1-10 , wherein the promoter is a T7 phage promoter, a lac promoter, a trp promoter, a recA promoter, a ribosomal RNA promoter, a Sp6 promoter, a araBad promoter, a pTac promoter, or a J23119 promoter.
12 . The method of claim 11 , wherein the promoter is a T7 phage promoter.
13 . The method of any one of claims 1-12 , wherein the insulating terminator sequence is located 27 to 37 nucleotides in the 5′ direction from the promoter.
14 . The method of any one of claims 1-13 , wherein the insulating terminator sequence is located 35 to 37 nucleotides in the 5′ direction from the promoter.
15 . The method of any one of claims 1-14 , wherein the insulating terminator sequence is located 37 nucleotides in the 5′ direction from the promoter.
16 . The method any one of claims 1-15 , wherein the insulating terminator sequence is 0 to 10,000 nucleotides in a 3′ direction of the ori.
17 . The method of claim 16 , wherein the insulating terminator sequence is located 30 to 40 nucleotides in the 3′ direction of the ori.
18 . The method of claim 17 , wherein the insulating terminator sequence is located 40 nucleotides in the 3′ direction of the ori.
19 . The method of claim 2 , wherein the synthesizing step comprises using a cell-free protein synthesis platform.
20 . The method of claim 19 , wherein the cell-free protein synthesis platform comprises a system for in vitro transcription of mRNA and/or translation of polypeptides.
21 . The method of any one of claims 1-20 , wherein the cell-free expression vector further comprises a Ribosome-binding site (RBS).
22 . The method of any one of claims 1-21 , wherein the cell-free expression vector further comprises an Open Reading Frame (ORF).
23 . A kit for use in a method of creating or modifying a cell-free expression vector, the kit comprising:
(a) a cell-free expression vector comprising
(i) an origin of replication (ori),
(ii) a nucleic acid sequence encoding a protein or RNA,
(iii) a promoter arranged to drive expression of the protein or RNA, and
(iv) one or more selectable markers;
(b) an insulating terminator sequence that is to be inserted at a location between 0 and 10,000 nucleotides in a 5′ direction from the promoter in the cell-free expression vector; and
(c) one or more cloning reagents.
24 . A kit for performing protein or RNA synthesis in vitro, the kit comprising:
(a) reagents for cell-free protein or RNA synthesis; and
(b) a cell-free expression vector comprising
(i) an origin of replication (ori);
(ii) a nucleic acid encoding protein or RNA to be synthesized;
(iii) a promoter arranged to drive expression of the protein or RNA;
(iv) an insulating terminator sequence that is located between 0 and 10,000 nucleotides in a 5′ direction from the promoter; and
(iv) one or more selectable markers.
25 . The kit of any one of claims 23-24 , wherein the insulating terminator sequence is mpB-T1 (SEQ ID NO: 820), rrnB T1 (SEQ ID NO: 14), L3S2P21 (SEQ ID NO: 318), or L3S2P56 (SEQ ID NO: 319).
26 . The kit of claim 25 , wherein the insulating terminator sequence is mpB-T1 (SEQ ID NO: 820).
27 . The kit of any one of claims 23-26 , wherein the promoter is a T7 phage promoter, a lac promoter, a trp promoter, a recA promoter, a ribosomal RNA promoter, a Sp6 promoter, a araBad promoter, a pTac promoter, or a J23119 promoter.
28 . The kit of claim 27 , wherein the promoter is a T7 phage promoter.
29 . The kit of any one of claims 23-28 , wherein the insulating terminator is located between 0 and 10,000 nucleotides in a 5′ direction from the promoter
30 . The kit of any one of claims 23-29 , wherein the insulating terminator sequence is located 27 to 37 nucleotides in the 5′ direction from the promoter.
31 . The kit of any one of claims 23-30 , wherein the insulating terminator sequence is located 35 to 37 nucleotides in the 5′ direction from the promoter.
32 . The kit of any one of claims 23-31 , wherein the insulating terminator sequence is located 37 nucleotides in the 5′ direction from the promoter.
33 . The kit of any one of claims 23-32 , wherein the insulating terminator sequence is 0 to 10,000 nucleotides in a 3′ direction of the ori.
34 . The kit of any one of claims 23-33 , wherein the insulating terminator sequence is located 30 to 40 nucleotides in the 3′ direction of the ori.
35 . The kit of any one of claims 23-34 , wherein the insulating terminator sequence is located 40 nucleotides in the 3′ direction of the ori.
36 . The kit of any one of claims 23-35 , wherein the cell-free expression vector further comprises a Ribosome-binding site (RBS).
37 . The kit of any one of claims 23-36 , wherein the cell-free expression vector further comprises an Open Reading Frame (ORF).
38 . A cell-free expression vector comprising:
(i) an origin of replication (ori),
(ii) a nucleic acid sequence encoding a protein or RNA,
(iii) a promoter arranged to drive expression of the protein or RNA,
(iv) one or more selectable markers, and
(v) an insulating terminator sequence at a location that is between 0 and 10,000 nucleotides in a 5′ direction from the promoter.
39 . The cell-free expression vector of claim 38 , wherein the insulating terminator sequence is mnpB-T1 (SEQ ID NO: 820), rrnB T1 (SEQ ID NO: 14), L3S2P21 (SEQ ID NO: 318), or L3S2P56 (SEQ ID NO: 319).
40 . The cell-free expression vector of claim 39 , wherein the insulating terminator sequence is rnpB-T1 (SEQ ID NO: 820).
41 . The cell-free expression vector of any one of claims 38-40 , wherein the promoter is a T7 phage promoter, a lac promoter, a trp promoter, a recA promoter, a ribosomal RNA promoter, a Sp6 promoter, a araBad promoter, a pTac promoter, or a J23119 promoter.
42 . The cell-free expression vector of 41, wherein the promoter is a T7 phage promoter.
43 . The cell-free expression vector of claim 43 , wherein the vector comprises a backbone.
44 . The cell-free expression vector of any one of claims 38-42 , wherein the backbone is from one of the following vectors: pJL1, pY71, p70a, pBEST, pEXP5, or pT7CFE.
45 . The cell-free expression vector of claim 44 , wherein the backbone is from a pJL1 plasmid.
46 . The cell-free expression of any one of claims 38-45 , wherein at least a portion of the cell-free expression vector comprises the following sequence: gggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttccggcttatcggtcagtttcacctgattt acgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtccacgacgctatacccaaaagaaa gctggccttttgctcacatgttcttatcccgcgaaattaatacgactcactatag (SEQ ID NO: 818).
47 . The cell-free expression vector of any one of claims 38-46 , comprising, consisting of, or consisting essentially of the features shown in FIG. 5 .
48 . The cell-free expression vector of any one of claims 38-47 , wherein the insulating terminator is located between 0 and 10,000 nucleotides in a 5′ direction from the promoter
49 . The cell-free expression vector of any one of claims 38-48 , wherein the insulating terminator sequence is located 27 to 37 nucleotides in the 5′ direction from the promoter.
50 . The cell-free expression vector of any one of claims 38-49 , wherein the insulating terminator sequence is located 35 to 37 nucleotides in the 5′ direction from the promoter.
51 . The cell-free expression vector of any one of claims 38-50 , wherein the insulating terminator sequence is located 37 nucleotides in the 5′ direction from the promoter.
52 . The cell-free expression vector of any one of claims 38-51 , wherein the insulating terminator sequence is 0 to 10,000 nucleotides in a 3′ direction of the ori.
53 . The cell-free expression vector of any one of claims 38-52 , wherein the insulating terminator sequence is located 30 to 40 nucleotides in the 3′ direction of the ori.
54 . The cell-free expression vector of any one of claims 38-53 , wherein the insulating terminator sequence is located 40 nucleotides in the 3′ direction of the ori.
55 . The cell-free expression vector of any one of claims 38-54 , wherein the cell-free expression vector further comprises a Ribosome-binding site (RBS).
56 . The cell-free expression vector of any one of claims 38-55 , wherein the cell-free expression vector further comprises an Open Reading Frame (ORF).