COMPOSITIONS AND METHODS FOR MODULATING CXCL9, CXCL10, AND CXCL11 GENE EXPRESSION
The present invention provides agents and compositions for reducing expression of a CXCL9, CXCL10, and/or CXCL11 gene by targeting expression control region associated with CXCL9, CXCL10, and/or CXCL11 gene and methods of use thereof for treating a disease or disorder associated with CXCL9, CXCL10, and/or CXCL11, e.g., liver disease.
1 . A site-specific epigenetic modifying agent, comprising at least one site-specific targeting moiety which targets a target sequence within an expression control region of human CXCL9, CXCL10, or CXCL11.
2 . The epigenetic modifying agent of claim 1 , wherein the target sequence is within a human chromosomal region selected from the group consisting of chr4: 76928543-76931536, chr4: 76944524-76948668, chr4: 76957098-76962383, chr4: 76949523-76949873, chr4: 76932906-76933929, chr4: 76916900-76917300, chr4: 76988761-76989260, chr4: 77008274-77008727, and chr4: 76957852-76958551.
3 . The epigenetic modifying agent of claim 1 , wherein the target sequence is located within about 100 bp, about 200 bp, about 300 bp, about 400 bp, about 450 bp, about 500 bp, about 550 bp, about 600 bp, about 650 bp, about 700 bp, about 750 bp, about 800 bp, about 850 bp, about 900 bp, about 950 bp, about 1 kb, about 1.1 kb, about 1.2 kb, about 1.3 kb, about 1.4 kb, about 1.5 kb, about 1.6 kb, about 1.7 kb, about 1.8 kb, about 1.9 kb, about 2.0 kb, about 2.1 kb, about 2.2 kb, about 2.3 kb, about 2.4 kb, about 2.5 kb, about 2.6 kb, about 2.7 kb, about 2.8 kb, about 2.9 kb, or about 3.0 kb from a human chromosomal region selected from the group consisting of chr4: 76958201-76958221, chr4: 76949758-76949778, chr4: 76933245-76933265, chr4: 76932967-76932987, chr4: 76957115-76957132, chr4: 76944734-76944751, chr4: 76944656-76944673, and chr4: 76933040-76933057.
4 . The epigenetic modifying agent of any one of claims 1-3 , wherein the target sequence comprises a sequence selected from the group consisting of AGCCATGACACTGCACTACCC (SEQ ID NO: 422), ATTCTGCACCAGCTGAGGGGA (SEQ ID NO: 423), GATCCAAATGCTAATGTAACC (SEQ ID NO: 424), GCATGACAAGTTCCTAAACGA (SEQ ID NO: 425), GAAGGGCATGGCTATAGC (SEQ ID NO: 429), GACTTAGCAAAACCTGCT (SEQ ID NO: 430), GGCACACTAGCCCCACGT (SEQ ID NO: 431), and GCAACGATCAATGGGATT (SEQ ID NO: 432).
5 . The site specific epigenetic modifying agent any one of claims 1-4 , comprising at least two site specific targeting moieties, each of which independently targets CXCL9, CXCL10 or CXCL11.
6 . The epigenetic modifying agent of any one of claims 1-5 , wherein the site-specific targeting moiety comprises a polymeric molecule.
7 . The epigenetic modifying agent of claim 6 , wherein the polymeric molecule comprises a polyamide.
8 . The epigenetic modifying agent of claim 6 or 7 , wherein the polymeric molecule comprises a polynucleotide.
9 . The epigenetic modifying agent of any one of claims 1-8 , wherein the expression control region comprises at least one specific transcriptional control element for CXCL9, CXCL10, or CXCL11.
10 . The site specific epigenetic modifying agent of claim 1 comprising at least two specific transcriptional control elements, each of which independently reduces transcription of CXCL9, CXCL10 or CXCL11.
11 . The epigenetic modifying agent of claim 9 or 10 , wherein the transcriptional control element comprises a promoter for CXCL9, CXCL10, or CXCL11.
12 . The epigenetic modifying agent of any one of claims 9-11 , wherein the transcriptional control element comprises an enhancer for CXCL9, CXCL10, or CXCL11.
13 . The epigenetic modifying agent of any one of claims 1-9 , wherein the site-specific targeting moiety comprises a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide identity to the entire nucleotide sequence of any of the nucleotide sequences in any one of Table 3 or Table 5.
14 . The epigenetic modifying agent of any one of claims 6-13 , wherein the polymeric molecule comprises a polynucleotide encoding a Cas or dCas polypeptide, or a fragment thereof, and a polynucleotide encoding a guide RNA that specifically binds to the expression control region of CXCL9, CXCL10, or CXCL11; or a DNA-binding domain of a Transcription activator-like effector (TALE) polypeptide or a zinc finger (ZFP) polypeptide, or fragment thereof, that specifically binds to the expression control region of CXCL9, CXCL10, or CXCL11.
15 . The epigenetic modifying agent of claim 14 , wherein the DNA-binding domain of the ZFP or TALE polypeptide comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of any one of the amino acid sequences listed in Table 3 or Table 5.
16 . The epigenetic modifying agent of any one of claims 1-15 , wherein the expression control region comprises
1) one or more CXCL9-associated anchor sequences within an anchor sequence-mediated conjunction comprising a first and a second CXCL9-associated anchor sequence;
2) one or more CXCL10-associated anchor sequences within an anchor sequence-mediated conjunction comprising a first and a second CXCL10-associated anchor sequence; or
3) one or more CXCL11-associated anchor sequences within an anchor sequence-mediated conjunction comprising a first and a second CXCL11-associated anchor sequence.
17 . The epigenetic modifying agent of any one of claims 1-16 , wherein the expression control region comprises one or more CCCTC-binding factor (CTCF) binding motifs.
18 . The epigenetic modifying agent of claim 16 or 17 , wherein the anchor sequence-mediated conjunction comprises one or more transcriptional control elements internal to the conjunction.
19 . The epigenetic modifying agent of claim 16 or 17 , wherein the anchor sequence-mediated conjunction comprises one or more transcriptional control elements external to the conjunction.
20 . The epigenetic modifying agent of any one of claims 16-19 , wherein the first and/or the second anchor sequence is located within about 500 kb of the transcriptional control element.
21 . The epigenetic modifying agent of claim 20 , wherein the first and/or the second anchor sequence is located within about 300 kb of the transcriptional control element.
22 . The epigenetic modifying agent of claim 21 , wherein the first and/or the second anchor sequence is located within 10 kb of the transcriptional control element.
23 . The epigenetic modifying agent any one of claims 6-22 , wherein the polymeric molecule comprises a polynucleotide encoding a DNA-binding domain, or fragment thereof, of a zinc finger polypeptide (ZFP) or a transcription activator-like effector (TALE) polypeptide that specifically binds to the expression control region of CXCL9, CXCL10, or CXCL11.
24 . The epigenetic modifying agent of claim 20 , wherein the DNA-binding domain of the ZFP or TALE polypeptide comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of any one of the amino acid sequences listed in Table 3 or Table 5.
25 . The epigenetic modifying agent of any one of claims 1-24 , wherein the epigenetic modifying agent comprises a nucleotide modification.
26 . The epigenetic modifying agent any one of claims 6-24 , wherein the polymeric molecule comprises a peptide nucleic acid (PNA).
27 . A nucleic acid molecule, wherein the nucleic acid molecule encodes the epigenetic modifying agent of any one of claims 1-26 .
28 . A vector comprising the epigenetic modifying agent of any one of claims 1-27 .
29 . The vector of claim 28 , wherein the vector is a viral expression vector.
30 . A cell comprising the epigenetic modifying agent of any one of claims 1-26 or the vector of claim 28 or 29 .
31 . A composition comprising the epigenetic modifying agent of any one of claims 1-26 .
32 . The composition of claim 31 , wherein the composition comprises at least two epigenetic modifying agents, each of which independently targets an expression control region of one of CXCL9, CXCL10, or CXCL11.
33 . The composition of claim 31 or 32 , wherein the composition comprises at least three epigenetic modifying agent, each of which targets an expression control region of one of CXCL9, CXCL10, or CXCL11.
34 . The composition of claim 31 , wherein the composition comprises an epigenetic modifying agent which targets the expression control region of at least two of CXCL9, CXCL10, or CXCL11.
35 . The composition of any one of claims 31-34 , wherein the composition comprises a pharmaceutical composition.
36 . The composition of claim 35 , wherein the pharmaceutical composition comprises a lipid formulation.
37 . The composition of claim 36 , wherein the lipid formulation comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, or one or more PEG-modified lipids, or combinations of any of the foregoing.
38 . The composition of claim 35 , wherein the pharmaceutical composition comprises a lipid nanoparticle.
39 . An epigenetic modifying agent, comprising at least one nucleic acid molecule encoding a fusion protein, the fusion protein comprising a site-specific targeting moiety which targets a target sequence within an expression control region of human CXCL9, CXCL10, or CXCL11, and an effector molecule.
40 . The epigenetic modifying agent of claim 39 , wherein the target sequence is within a human chromosomal region selected from the group consisting of chr4: 76928543-76931536, chr4: 76944524-76948668, chr4: 76957098-76962383, chr4: 76949523-76949873, chr4: 76932906-76933929, chr4: 76916900-76917300, chr4: 76988761-76989260, chr4: 77008274-77008727, and chr4: 76957852-76958551.
41 . The epigenetic modifying agent of claim 39 , wherein target sequence is located within about 100 bp, about 200 bp, about 300 bp, about 400 bp, about 450 bp, about 500 bp, about 550 bp, about 600 bp, about 650 bp, about 700 bp, about 750 bp, about 800 bp, about 850 bp, about 900 bp, about 950 bp, about 1 kb, about 1.1 kb, about 1.2 kb, about 1.3 kb, about 1.4 kb, about 1.5 kb, about 1.6 kb, about 1.7 kb, about 1.8 kb, about 1.9 kb, about 2.0 kb, about 2.1 kb, about 2.2 kb, about 2.3 kb, about 2.4 kb, about 2.5 kb, about 2.6 kb, about 2.7 kb, about 2.8 kb, about 2.9 kb, or about 3.0 kb from a human chromosomal region selected from the group consisting of chr4: 76958201-76958221, chr4: 76949758-76949778, chr4: 76933245-76933265, chr4: 76932967-76932987, chr4: 76957115-76957132, chr4: 76944734-76944751, chr4: 76944656-76944673, and chr4: 76933040-76933057.
42 . The epigenetic modifying agent of any one of claims 38-41 , wherein the target sequence comprises a sequence selected from the group consisting of AGCCATGACACTGCACTACCC (SEQ ID NO: 422), ATTCTGCACCAGCTGAGGGGA (SEQ ID NO: 423), GATCCAAATGCTAATGTAACC (SEQ ID NO: 424), GCATGACAAGTTCCTAAACGA (SEQ ID NO: 425), GAAGGGCATGGCTATAGC (SEQ ID NO: 429), GACTTAGCAAAACCTGCT (SEQ ID NO: 430), GGCACACTAGCCCCACGT (SEQ ID NO: 431), and GCAACGATCAATGGGATT (SEQ ID NO: 432).
43 . The epigenetic modifying agent of claim 38-42 , wherein the site-specific targeting moiety comprises a polynucleotide encoding a Cas or dCas polypeptide, or a fragment thereof, and a polynucleotide encoding a guide RNA that specifically binds to the expression control region of CXCL9, CXCL10, or CXCL11; or a DNA-binding domain of a Transcription activator-like effector (TALE) polypeptide or a zinc finger (ZFP) polypeptide, or fragment thereof, that specifically binds to the expression control region of CXCL9, CXCL10, or CXCL11.
44 . The epigenetic modifying agent of claim 43 , wherein the DNA-binding domain of the zinc finger polypeptide (ZFP) or TALE polypeptide comprises an amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of an amino acid sequence selected from the amino acid sequences listed in Table 3 or Table 5.
45 . The epigenetic modifying agent of any one of claims 38-44 , wherein the effector molecule comprises a polypeptide or a nucleic acid molecule encoding a polypeptide.
46 . The epigenetic modifying agent of any one of claims 38-45 , wherein the fusion protein comprises a peptide-nucleic acid fusion.
47 . The epigenetic modifying agent of any one of claims 38-46 , wherein the effector is selected from the group consisting of a nuclease, a physical blocker, an epigenetic recruiter, an epigenetic modifier, and combinations of any of the foregoing.
48 . The epigenetic modifying agent of claim 47 , wherein the effector is selected from the group consisting of euchromatic histone-lysine N-methyltransferase 2 (G9a), enhancer of zeste homolog 2 (EZH2), MQ1 domain (MQ1), Krüppel associated box (KRAB) transcriptional repression domain, and histone deacetylase 8 (HDAC8).
49 . The epigenetic modifying agent of claim 48 , wherein the effector is MQ1.
50 . The epigenetic modifying agent of claim 49 , wherein the effector comprises a CRISPR associated protein (Cas) polypeptide or nucleic acid molecule encoding the Cas polypeptide.
51 . The epigenetic modifying agent of claim 50 , wherein the Cas polypeptide is an enzymatically inactive Cas polypeptide.
52 . The epigenetic modifying agent of claim 50 or 51 , further comprising a catalytically active domain of human exonuclease 1 (hEXO1).
53 . The epigenetic modifying agent of claim 47 , wherein the epigenetic modifier comprises a transcriptional repressor.
54 . The epigenetic modifying agent of claim 53 , wherein the transcriptional repressor is selected from the group comprising euchromatic histone-lysine N-methyltransferase 2 (G9a), enhancer of zeste homolog 2 (EZH2), MQ1 domain (MQ1), Krüppel associated box (KRAB) transcriptional repression domain, and histone deacetylase 8 (HDAC8).
55 . The epigenetic modifying agent of claim 54 , wherein the transcriptional repressor is MQ1 domain.
56 . The epigenetic modifying agent of claim 55 , wherein the MQ1 domain comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of SEQ ID NO: 79.
57 . The epigenetic modifying agent of claim 55 or 56 , wherein the transcriptional repressor comprises two, three, four, or five MQ1s.
58 . The epigenetic modifying agent of claim 57 , wherein the transcriptional repressor is a EZH2.
59 . The epigenetic modifying agent of claim 58 , wherein the EZH2 comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the entire amino acid sequence of SEQ ID NO: 78.
60 . The epigenetic modifying agent of claim 47 , wherein the epigenetic modifier comprises a DNA methylase or a histone deacetylase.
61 . The epigenetic modifying agent of claim 48 , wherein the effector molecule comprises a Krüppel associated box (KRAB) transcriptional repression domain.
62 . The epigenetic modifying agent of claim 61 , wherein the KRAB comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the entire amino acid sequence of SEQ ID NO: 297.
63 . The epigenetic modifying agent of any one of claims 39-62 , wherein the effector molecule comprises a Transcription activator-like effector nuclease (TALEN) polypeptide.
64 . The epigenetic modifying agent of any one of claims 39-63 , further comprising a second nucleic acid molecule encoding a second fusion protein, wherein
1) the second fusion protein comprises a second site-specific targeting moiety which targets a second expression control region of CXCL9, CXCL10 or CXCL11, which is the same or different than the target of the first site-specific targeting moiety;
2) the second fusion protein comprises a second site-specific targeting moiety which targets a second CXCL9 expression control region and a second effector molecule, wherein the second CXCL9 expression control region is different than the CXCL9 expression control region;
3) the second fusion protein comprises a second site-specific targeting moiety which targets a second CXCL10 expression control region and a second effector molecule, wherein the second CXCL10 expression control region is different than the CXCL10 expression control region; and/or
4) the second fusion protein comprises a second site-specific targeting moiety which targets a second CXCL11 expression control region and a second effector molecule, wherein the second CXCL11 expression control region is different than the CXCL11 expression control region.
65 . The epigenetic modifying agent of claim 64 , wherein the first nucleic acid molecule and the second nucleic acid molecule are located on the same nucleic acid molecule or on different nucleic acid molecules.
66 . The epigenetic modifying agent of any of claims 39-65 , wherein
1) the epigenetic modifying agent targets a CXCL9 expression control region comprising either a ZF target sequence comprising SEQ ID NOs: 422-425, or TALE target sequence comprising SEQ ID NOs: 429-432, or a combination thereof, and a second CXCL9 expression control region comprising either a ZF target sequence comprising SEQ ID NOs: 422-425, or TALE target sequence comprising SEQ ID NOs: 429-432, or a combination thereof; and/or
2) the epigenetic modifying agent targets a CXCL10 expression control region comprising either a ZF target sequence comprising SEQ ID NOs: 422-425, or TALE target sequence comprising SEQ ID NOs: 429-432, or a combination thereof, and a second CXCL10 expression control region comprising either a ZF target sequence comprising SEQ ID NOs: 422-425, or TALE target sequence comprising SEQ ID NOs: 429-432, or a combination thereof; and/or
3) the epigenetic modifying agent targets a CXCL11 expression control region comprising either a ZF target sequence comprising SEQ ID NOs: 422-425, or TALE target sequence comprising SEQ ID NOs: 429-432, or a combination thereof, a second CXCL11 expression control region comprising either a ZF target sequence comprising SEQ ID NOs: 422-425, or TALE target sequence comprising SEQ ID NOs: 429-432, or a combination thereof.
67 . The epigenetic modifying agent of claim 65 or 66 , wherein the second effector is different than the effector.
68 . The epigenetic modifying agent of claim 67 , wherein the second effector is the same as the effector.
69 . The epigenetic modifying agent of any one of claims 65-68 , wherein the fusion protein and the second fusion protein are operably linked.
70 . The epigenetic modifying agent of any one of claims 39-69 , wherein the fusion protein, and, optionally, the second fusion protein independently comprise an amino acid sequence that has at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid sequence identity to the entire amino acid sequence of a polypeptide selected from the group consisting of ZF05-KRAB (SEQ ID NO: 467), ZF07-KRAB (SEQ ID NO: 461), ZF16-KRAB (SEQ ID NO: 464), ZF24-KRAB (SEQ ID NO: 463), ZF05-MQ1 (SEQ ID NO: 466), ZF07-MQ1 (SEQ ID NO: 465), TAL04-KRAB (SEQ ID NO: 471), TAL08-KRAB (SEQ ID NO: 470), TAL09-KRAB (SEQ ID NO: 469), and TAL14-KRAB (SEQ ID NO: 468).
71 . The epigenetic modifying agent of any one of claims 39-70 , wherein the fusion protein, and optionally, the second fusion protein, are independently encoded by a polynucleotide comprising a nucleotide sequence that has at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to the entire nucleotide sequence of a polynucleotide selected from the group consisting of ZF05-KRAB (SEQ ID NO: 467), ZF07-KRAB (SEQ ID NO: 461), ZF16-KRAB (SEQ ID NO: 464), ZF24-KRAB (SEQ ID NO: 463), ZF05-MQ1 (SEQ ID NO: 466), ZF07-MQ1 (SEQ ID NO: 465), TAL04-KRAB (SEQ ID NO: 471), TAL08-KRAB (SEQ ID NO: 470), TAL09-KRAB (SEQ ID NO: 469), and TAL14-KRAB (SEQ ID NO: 468).
72 . An epigenetic modifying agent, comprising a nucleic acid molecule encoding a fusion protein, wherein the fusion protein comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of a polypeptide selected from the group consisting of ZF05-KRAB (SEQ ID NO: 467), ZF07-KRAB (SEQ ID NO: 461), ZF16-KRAB (SEQ ID NO: 464), ZF24-KRAB (SEQ ID NO: 463), ZF05-MQ1 (SEQ ID NO: 466), ZF07-MQ1 (SEQ ID NO: 465), TAL04-KRAB (SEQ ID NO: 471), TAL08-KRAB (SEQ ID NO: 470), TAL09-KRAB (SEQ ID NO: 469), and TAL14-KRAB (SEQ ID NO: 468).
73 . The epigenetic modifying agent of claim 72 , wherein the polypeptide is ZF05-KRAB.
74 . The epigenetic modifying agent of claim 72 , wherein the polypeptide is ZF07-KRAB.
75 . The epigenetic modifying agent of claim 72 , wherein the polypeptide is ZF16-KRAB.
76 . The epigenetic modifying agent of claim 72 , wherein the polypeptide is ZF24-KRAB.
77 . The epigenetic modifying agent of claim 72 , wherein the polypeptide is ZF05-MQ1.
78 . The epigenetic modifying agent of claim 72 , wherein the polypeptide is ZF07-MQ1.
79 . The epigenetic modifying agent of claim 72 , wherein the polypeptide is TAL04-KRAB.
80 . The epigenetic modifying agent of claim 72 , wherein the polypeptide is TAL08-KRAB.
81 . The epigenetic modifying agent of claim 72 , wherein the polypeptide is TAL09-KRAB.
82 . The epigenetic modifying agent of claim 72 , wherein the polypeptide is TAL14-KRAB.
83 . An epigenetic modifying agent, comprising a nucleic acid molecule encoding two or more fusion proteins, wherein each fusion protein independently comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of a polypeptide selected from the group consisting of ZF05-KRAB (SEQ ID NO: 467), ZF07-KRAB (SEQ ID NO: 461), ZF16-KRAB (SEQ ID NO: 464), ZF24-KRAB (SEQ ID NO: 463), ZF05-MQ1 (SEQ ID NO: 466), ZF07-MQ1 (SEQ ID NO: 465), TAL04-KRAB (SEQ ID NO: 471), TAL08-KRAB (SEQ ID NO: 470), TAL09-KRAB (SEQ ID NO: 469), and TAL14-KRAB (SEQ ID NO: 468).
84 . A vector comprising a nucleic acid molecule encoding the epigenetic modifying agent of any one of claims 39-83 .
85 . The vector of claim 84 , wherein the vector is a viral expression vector.
86 . A cell comprising the epigenetic modifying agent of any one of claims 39-83 or the vector of claim 84 or 85 .
87 . The cell of claim 86 , wherein the cell is an immune cell.
88 . A composition comprising the epigenetic modifying agent of any one of claims 39-83 .
89 . The composition of claim 88 , wherein the composition comprises at least one epigenetic modifying agent that targets an expression control region of CXCL9, CXCL10, or CXCL11.
90 . The composition of claim 88 or 89 , wherein the composition comprises at least two epigenetic modifying agent, each of which independently targets an expression control region of CXCL9, CXCL10, or CXCL11.
91 . The composition of any one of claims 88-90 , wherein the composition comprises at least three epigenetic modifying agent, each of which targets an expression control region of CXCL9, CXCL10, or CXCL11.
92 . The composition of any one of claims 88-91 , wherein the composition comprises a pharmaceutical composition.
93 . The composition of claim 92 , wherein the pharmaceutical composition comprises a lipid formulation.
94 . The composition of claim 93 , wherein the lipid formulation comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, or one or more PEG-modified lipids, or combinations of any of the foregoing.
95 . The composition of claim 93 , wherein the pharmaceutical composition comprises a lipid nanoparticle.
96 . A method of reducing expression of CXCL9, CXCL10, or CXCL11 in a cell, the method comprising contacting the cell with at least one epigenetic modifying agent, each epigenetic modifying agent comprising at least one site-specific targeting moiety which targets a target sequence within an expression control region of human CXCL9, CXCL10, or CXCL11, and an effector molecule, thereby reducing expression of human CXCL9, CXCL10, or CXCL11 in the cell.
97 . The method of claim 96 , wherein the target sequence is within a human chromosomal region selected from the group consisting of chr4: 76928543-76931536, chr4: 76944524-76948668, chr4: 76957098-76962383, chr4: 76949523-76949873, chr4: 76932906-76933929, chr4: 76916900-76917300, chr4: 76988761-76989260, chr4: 77008274-77008727, and chr4: 76957852-76958551.
98 . The method of claim 96 , wherein the target sequence is located within about 100 bp, about 200 bp, about 300 bp, about 400 bp, about 450 bp, about 500 bp, about 550 bp, about 600 bp, about 650 bp, about 700 bp, about 750 bp, about 800 bp, about 850 bp, about 900 bp, about 950 bp, about 1 kb, about 1.1 kb, about 1.2 kb, about 1.3 kb, about 1.4 kb, about 1.5 kb, about 1.6 kb, about 1.7 kb, about 1.8 kb, about 1.9 kb, about 2.0 kb, about 2.1 kb, about 2.2 kb, about 2.3 kb, about 2.4 kb, about 2.5 kb, about 2.6 kb, about 2.7 kb, about 2.8 kb, about 2.9 kb, or about 3.0 kb from a human chromosomal region selected from the group consisting of chr4: 76958201-76958221, chr4: 76949758-76949778, chr4: 76933245-76933265, chr4: 76932967-76932987, chr4: 76957115-76957132, chr4: 76944734-76944751, chr4: 76944656-76944673, and chr4: 76933040-76933057.
100 . The method of any one of claims 96-98 , wherein the target sequence comprises a sequence selected from the group consisting of AGCCATGACACTGCACTACCC (SEQ ID NO: 422), ATTCTGCACCAGCTGAGGGGA (SEQ ID NO: 423), GATCCAAATGCTAATGTAACC (SEQ ID NO: 424), GCATGACAAGTTCCTAAACGA (SEQ ID NO: 425), GAAGGGCATGGCTATAGC (SEQ ID NO: 429), GACTTAGCAAAACCTGCT (SEQ ID NO: 430), GGCACACTAGCCCCACGT (SEQ ID NO: 431), and GCAACGATCAATGGGATT (SEQ ID NO: 432).
101 . The method of any one of claims 96-100 , wherein the epigenetic modifying agent comprises at least two site specific targeting moieties, each of which independently targets CXCL9, CXCL10 or CXCL11.
102 . The method of claim 96-101 , wherein the expression of CXCL9, CXCL10, or CXCL11 in the cell is reduced by at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% compared to prior to contacting the cell with the at least one epigenetic modifying agent.
103 . The method of claim 96-102 , wherein the expression of CXCL9, CXCL10, or CXCL11 in the cell is reduced between about 30% to about 100%, about 30% to about 95%, about 30% to about 90%, about 30% to about 85%, about 30% to about 80%, about 30% to about 75%, about 30% to about 70%, about 30% to about 65%, about 30% to about 60%, about 30% to about 55%, about 30% to about 50%, about 30% to about 45%, about 30% to about 40%, about 35% to about 100%, about 35% to about 95%, about 35% to about 90%, about 35% to about 85%, about 35% to about 80%, about 35% to about 75%, about 35% to about 70%, about 35% to about 65%, about 35% to about 60%, about 35% to about 55%, about 35% to about 50%, about 35% to about 45%, about 40% to about 100%, about 40% to about 95%, about 40% to about 90%, about 40% to about 85%, about 40% to about 80%, about 40% to about 75%, about 40% to about 70%, about 40% to about 65%, about 40% to about 60%, about 40% to about 55%, about 40% to about 50%, about 40% to about 45%, about 45% to about 100%, about 45% to about 95%, about 45% to about 90%, about 45% to about 85%, about 45% to about 80%, about 45% to about 75%, about 45% to about 70%, about 45% to about 65%, about 45% to about 60%, about 45% to about 55%, about 45% to about 50%, about 50% to about 100%, about 50% to about 95%, about 50% to about 90%, about 50% to about 85%, about 50% to about 80%, about 50% to about 75%, about 50% to about 70%, about 50% to about 65%, about 50% to about 60%, about 50% to about 55%, about 55% to about 100%, about 55% to about 95%, about 55% to about 90%, about 55% to about 85%, about 55% to about 80%, about 55% to about 75%, about 55% to about 70%, about 55% to about 65%, about 55% to about 60%, about 60% to about 100%, about 60% to about 95%, about 60% to about 90%, about 60% to about 85%, about 60% to about 80%, about 60% to about 75%, about 60% to about 70%, about 60% to about 65%, about 65% to about 100%, about 65% to about 95%, about 65% to about 90%, about 65% to about 85%, about 65% to about 80%, about 65% to about 75%, about 65% to about 70%, about 70% to about 100%, about 70% to about 95%, about 70% to about 90%, about 70% to about 85%, about 70% to about 80%, about 70% to about 75%, about 75% to about 100%, about 75% to about 95%, about 75% to about 90%, about 75% to about 85%, about 75% to about 80%, about 80% to about 100%, about 80% to about 95%, about 80% to about 90%, about 80% to about 85%, about 85% to about 100%, about 85% to about 95%, about 85% to about 90%, about 90% to about 100%, about 90% to about 95%, or about 95% to about 100% compared to prior to contacting the cell with the at least one epigenetic modifying agent.
104 . The method of any one of claims 96-103 , wherein the site-specific targeting moiety comprises a polymeric molecule.
105 . The method of claim 104 , wherein the polymeric molecule comprises a polyamide.
106 . The method of claim 104 or 105 , wherein the polymeric molecule comprises a polynucleotide.
107 . The method of any one of claims 96-106 , wherein the expression control region comprises a specific transcriptional control element for CXCL9, CXCL10, or CXCL11.
108 . The method of any one of claims 96-107 , wherein the epigenetic modifying agent targets at least two specific transcriptional control elements, each of which independently reduces transcription of CXCL9, CXCL10 or CXCL11.
109 . The method of claim 107 or 108 , wherein the transcriptional control element comprises a promoter for CXCL9, CXCL10, or CXCL11.
110 . The method of claim 109 , wherein the transcriptional control element comprises an enhancer for CXCL9, CXCL10, or CXCL11.
111 . The method of any one of claims 96-110 , wherein the epigenetic modifying agent comprises a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide identity to the entire nucleotide sequence of any of the nucleotide sequences in any one of Table 12 or Table 13.
112 . The method of any one of claims 96-111 , wherein the epigenetic modifying agent comprises a polynucleotide encoding a Cas or dCas polypeptide, a DNA-binding domain of a Transcription activator-like effector (TALE) polypeptide, or a zinc finger (ZFP) polypeptide, or fragment thereof, that specifically targets the expression control region of CXCL9, CXCL10, or CXCL11.
113 . The method of claim 112 , wherein the DNA-binding domain of the ZFP or TALE comprises an amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of an amino acid sequence selected from the amino acid sequences listed in Table 3 or Table 5.
114 . The method of any one of claims 96-113 , wherein the expression control region comprises
1) one or more CXCL9-associated anchor sequences within an anchor sequence-mediated conjunction comprising a first and a second CXCL9-associated anchor sequence; and/or
2) one or more CXCL10-associated anchor sequences within an anchor sequence-mediated conjunction comprising a first and a second CXCL10-associated anchor sequence; and/or
3) one or more CXCL11-associated anchor sequences within an anchor sequence-mediated conjunction comprising a first and a second CXCL11-associated anchor sequence.
115 . The method of claim 114 , wherein the anchor sequence comprises a CCCTC-binding factor (CTCF) binding motif.
116 . The method of claim 114 or 115 , wherein the anchor sequence-mediated conjunction comprises one or more transcriptional control elements internal to the conjunction.
117 . The method of claim 114 or 115 , wherein the anchor sequence-mediated conjunction comprises one or more transcriptional control elements external to the conjunction.
118 . The method of any one of claims 114-117 , wherein the first and/or the second anchor sequence is located within about 500 kb of the transcriptional control element.
119 . The method of claim 118 , wherein the first and/or the second anchor sequence is located within about 300 kb of the transcriptional control element.
120 . The method of any one of claims 114-119 , wherein the anchor sequence is located within 10 kb of the transcriptional control element.
121 . The method of any one of claims 96-120 , wherein the expression control region comprises a specific transcriptional control element for CXCL9, CXCL10, or CXCL11.
122 . The method of claim 121 , wherein the transcriptional control element comprises a promoter for CXCL9, CXCL10, or CXCL11.
123 . The method of claim 121 , wherein the transcriptional control element comprises a transcriptional repressor.
124 . The method of any one of claims 96-123 , wherein the epigenetic modifying agent comprises a polynucleotide encoding a Cas or dCas polypeptide, a DNA-binding domain, or fragment thereof, of a zinc finger polypeptide (ZFP) that specifically binds to the expression control region of CXCL9, CXCL10, or CXCL11, or a transcription activator-like effector (TALE) polypeptide that specifically binds to the expression control region of CXCL9, CXCL10, or CXCL11.
125 . The method of claim 124 , wherein the DNA-binding domain of the ZFP comprises an amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of an amino acid sequence selected from the amino acid sequences listed in Table 3.
126 . The method of any one of claims 96-125 , wherein the epigenetic modifying agent comprises a nucleotide modification.
127 . The method of any one of claims 104-126 , wherein the polymeric molecule comprises a peptide nucleic acid (PNA).
128 . The method of any one of claims 96-127 , wherein the effector molecule comprises a polypeptide.
129 . The method of claim 128 , wherein the polypeptide comprises a nucleic acid molecule encoding a fusion protein comprising the site-specific targeting moiety which targets an expression regulatory region of CXCL9, CXCL10, or CXCL11, and the effector molecule.
130 . The method of claim 129 , wherein the fusion protein comprises a peptide-nucleic acid fusion molecule.
131 . The method of any one of claims 96-130 , wherein the effector is selected from the group consisting of a nuclease, a physical blocker, an epigenetic recruiter, and an epigenetic modifier, and combinations of any of the foregoing.
132 . The method of claim 131 , wherein the effector is selected from the group consisting of euchromatic histone-lysine N-methyltransferase 2 (G9a), enhancer of zeste homolog 2 (EZH2), MQ1 domain (MQ1), Krüppel associated box (KRAB) transcriptional repression domain, and histone deacetylase 8 (HDAC8).
133 . The method of claim 132 , wherein the effector is MQ1.
134 . The method of claim 132 , wherein the effector is KRAB.
135 . The method of claim 131 , wherein the effector comprises a CRISPR associated protein (Cas) polypeptide or nucleic acid molecule encoding the Cas polypeptide.
136 . The method of claim 135 , wherein the Cas polypeptide is an enzymatically inactive Cas polypeptide.
137 . The method of claim 135 or 136 , further comprising a catalytically active domain of human exonuclease 1 (hEXO1).
138 . The method of claim 135 , wherein the epigenetic modifier comprises a transcriptional repressor.
139 . The method of claim 138 , wherein the transcriptional repressor is selected from the group comprising euchromatic histone-lysine N-methyltransferase 2 (G9a), enhancer of zeste homolog 2 (EZH2), MQ1 domain (MQ1), Krüppel associated box (KRAB) transcriptional repression domain, and histone deacetylase 8 (HDAC8).
140 . The method of claim 139 , wherein the transcriptional repressor is MQ1 domain.
141 . The method of claim 140 , wherein the MQ1 domain comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of SEQ ID NO: 79.
142 . The method of any one of claims 139-141 , wherein the transcriptional repressor comprises two, three, four, or five MQ1s.
143 . The method of claim 139 , wherein the transcriptional repressor is EZH2.
144 . The method of claim 143 , wherein the EZH2 has an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of SEQ ID NO: 78.
145 . The method of claim 131 , wherein the epigenetic modifier comprises a DNA methylase or a histone deacetylase.
146 . The method of any one of claims 128-131 , wherein the effector molecule comprises a Krüppel associated box (KRAB) transcriptional repression domain.
147 . The method of claim 146 , wherein the KRAB comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the entire amino acid sequence of SEQ ID NO: 297.
148 . The method of any one of claims 128-131 , wherein the effector molecule comprises a Transcription activator-like effector nuclease (TALEN) polypeptide.
149 . The method of claim 129 , wherein the fusion protein comprises an enzymatically inactive Cas polypeptide and an epigenetic recruiter polypeptide.
150 . The method of claim 129 , wherein the fusion protein comprises an enzymatically active Cas polypeptide and an epigenetic modifier polypeptide.
151 . The method of any one of claims 96-150 , wherein the epigenetic modifying agent comprises a second nucleic acid molecule encoding a second fusion protein, wherein
1) the second fusion protein comprises a second site-specific targeting moiety which targets a second expression control region of CXCL9, CXCL10 or CXCL11, which is the same or different than the target of the first site-specific targeting moiety;
2) the second fusion comprises a second site-specific targeting moiety which targets a second CXCL9 expression control region and a second effector molecule, wherein the second CXCL9 expression control region is different than the CXCL9 expression control region; and/or
3) the second fusion comprises a second site-specific targeting moiety which targets a second CXCL10 expression control region and a second effector molecule, wherein the second CXCL10 expression control region is different than the CXCL10 expression control region; and/or
4) the second fusion comprises a second site-specific targeting moiety which targets a second CXCL11 expression control region and a second effector molecule, wherein the second CXCL10 expression control region is different than the CXCL11 expression control region.
152 . The method of any one of claims 96-151 , wherein
1) the epigenetic modifying agent targets a CXCL9 expression control region comprising either a ZF target sequence comprising SEQ ID NOs: 422-425, or TALE target sequence comprising SEQ ID NOs: 429-432, or a combination thereof and, optionally, a second CXCL9 expression control region comprising either a ZF target sequence comprising SEQ ID NOs: 422-425, or TALE target sequence comprising SEQ ID NOs: 429-432, or a combination thereof; and/or
2) the epigenetic modifying agent targets a CXCL10 expression control region comprising either a ZF target sequence comprising SEQ ID NOs: 422-425, or TALE target sequence comprising SEQ ID NOs: 429-432, or a combination thereof and, optionally, a second CXCL10 expression control region comprising either a ZF target sequence comprising SEQ ID NOs: 422-425, or TALE target sequence comprising SEQ ID NOs: 429-432, or a combination thereof; and/or
3) the epigenetic modifying agent targets a CXCL11 expression control region comprising either a ZF target sequence comprising SEQ ID NOs: 422-425, or TALE target sequence comprising SEQ ID NOs: 429-432, or a combination thereof and, optionally, a second CXCL11 expression control region comprising either a ZF target sequence comprising SEQ ID NOs: 422-425, or TALE target sequence comprising SEQ ID NOs: 429-432, or a combination thereof.
153 . The method of any one of claims 96-152 , wherein
1) the epigenetic modifying agent targets a CXCL9 expression control region comprising either a ZF target sequence comprising SEQ ID NOs: 422-425, or TALE target sequence comprising SEQ ID NOs: 429-432, or a combination thereof, and a second CXCL9 expression control region comprising either a ZF target sequence comprising SEQ ID NOs: 422-425, or TALE target sequence comprising SEQ ID NOs: 429-432, or a combination thereof; and/or
2) the epigenetic modifying agent targets a CXCL10 expression control region comprising either a ZF target sequence comprising SEQ ID NOs: 422-425, or TALE target sequence comprising SEQ ID NOs: 429-432, or a combination thereof, and a second CXCL10 expression control region comprising either a ZF target sequence comprising SEQ ID NOs: 422-425, or TALE target sequence comprising SEQ ID NOs: 429-432, or a combination thereof; and/or
3) the epigenetic modifying agent targets a CXCL11 expression control region comprising either a ZF target sequence comprising SEQ ID NOs: 422-425, or TALE target sequence comprising SEQ ID NOs: 429-432, or a combination thereof, and a second CXCL11 expression control region comprising either a ZF target sequence comprising SEQ ID NOs: 422-425, or TALE target sequence comprising SEQ ID NOs: 429-432, or a combination thereof.
154 . The method of any one of claims 151-153 , wherein the second effector is different than the effector.
155 . The method of any one of claims 151-153 , wherein the second effector is the same as the effector.
156 . The method of any one of claims 151-155 , wherein the fusion protein and the second fusion protein are operably linked.
157 . The method of claim 156 , wherein the fusion protein and the second fusion protein independently comprise an amino acid sequence that has at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the entire amino acid sequence of a polypeptide selected from the group consisting of ZF05-KRAB (SEQ ID NO: 467), ZF07-KRAB (SEQ ID NO: 461), ZF16-KRAB (SEQ ID NO: 464), ZF24-KRAB (SEQ ID NO: 463), ZF05-MQ1 (SEQ ID NO: 466), ZF07-MQ1 (SEQ ID NO: 465), TAL04-KRAB (SEQ ID NO: 471), TAL08-KRAB (SEQ ID NO: 470), TAL09-KRAB (SEQ ID NO: 469), and TAL14-KRAB (SEQ ID NO: 468).
158 . The method of any one of claims 96-157 , wherein the fusion protein comprises an amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the entire amino acid sequence of a polypeptide selected from the group consisting of ZF05-KRAB (SEQ ID NO: 467), ZF07-KRAB (SEQ ID NO: 461), ZF16-KRAB (SEQ ID NO: 464), ZF24-KRAB (SEQ ID NO: 463), ZF05-MQ1 (SEQ ID NO: 466), ZF07-MQ1 (SEQ ID NO: 465), TAL04-KRAB (SEQ ID NO: 471), TAL08-KRAB (SEQ ID NO: 470), TAL09-KRAB (SEQ ID NO: 469), and TAL14-KRAB (SEQ ID NO: 468).
159 . The method of claim 158 , wherein the polypeptide is ZF05-KRAB.
160 . The method of claim 158 , wherein the polypeptide is ZF07-KRAB.
161 . The method of claim 158 , wherein the polypeptide is ZF16-KRAB.
162 . The method of claim 158 , wherein the polypeptide is ZF24-KRAB.
163 . The method of claim 158 , wherein the polypeptide is ZF05-MQ1.
164 . The method of claim 158 , wherein the polypeptide is ZF07-MQ1.
165 . The method of claim 158 , wherein the polypeptide is TAL04-KRAB.
166 . The method of claim 158 , wherein the polypeptide is TAL08-KRAB.
167 . The method of claim 158 , wherein the polypeptide is TAL09-KRAB.
168 . The method of claim 158 , wherein the polypeptide is TAL14-KRAB.
169 . The method of any one of claims 158-168 , wherein the fusion protein, and optionally, the second fusion protein, are independently encoded by a polynucleotide comprising a nucleotide sequence that has at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to the entire nucleotide sequence of a polynucleotide selected from the group consisting of ZF05-KRAB (SEQ ID NO: 467), ZF07-KRAB (SEQ ID NO: 461), ZF16-KRAB (SEQ ID NO: 464), ZF24-KRAB (SEQ ID NO: 463), ZF05-MQ1 (SEQ ID NO: 466), ZF07-MQ1 (SEQ ID NO: 465), TAL04-KRAB (SEQ ID NO: 471), TAL08-KRAB (SEQ ID NO: 470), TAL09-KRAB (SEQ ID NO: 469), and TAL14-KRAB (SEQ ID NO: 468).
170 . The method of any one of claims 152-169 , wherein the administration of the epigenetic modifying agent and the second epigenetic modifying agent has a synergistic effect in reducing the expression of CXCL9, CXCL10, or CXCL11.
171 . The method of any one of claims 100-153 , wherein the expression control region comprises a sequence selected from ZF24 target sequence (SEQ ID NO: 422), ZF16 target sequence (SEQ ID NO: 423), ZF07 target sequence (SEQ ID NO: 424), ZF05 target sequence (SEQ ID NO: 425), TAL04 target sequence (SEQ ID NO: 429), TAL08 target sequence (SEQ ID NO: 430), TAL09 target sequence (SEQ ID NO: 431), and TAL14 target sequence (SEQ ID NO: 432).
172 . The method of claim 171 , wherein the first expression control region comprises a ZF05 target sequence (SEQ ID NO: 425) and the second expression control region comprises a TAL08 target sequence (SEQ ID NO: 430) or TAL14 target sequence (SEQ ID NO: 432).
173 . The method of claim 171 , wherein the expression control region comprises a ZF05 target sequence (SEQ ID NO: 425).
174 . The method of any one of claims 96-173 , wherein the epigenetic modifying agent, the effector, or both the epigenetic modifying agent and the effector are present in a vector.
175 . The method of claim 174 , wherein the epigenetic modifying agent and the effector are present in the same vector.
176 . The method of claim 174 , wherein the epigenetic modifying agent and the effector are present in different vectors.
177 . The method of any one of claims 174-176 , wherein the vector is a viral expression vector.
178 . The method of any one of claims 96-173 , wherein the epigenetic modifying agent, the effector, or both the epigenetic modifying agent and the effector are present in a composition.
179 . The method of claim 178 , wherein the epigenetic modifying agent and the effector are present in the same composition.
180 . The method of claim 178 , wherein the epigenetic modifying agent and the effector are present in different compositions.
181 . The method of any one of claims 178-180 , wherein the composition comprises a pharmaceutical composition.
182 . The method of claim 181 , wherein the pharmaceutical composition comprises a lipid formulation.
183 . The method of claim 182 , wherein the lipid formulation comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, or one or more PEG-modified lipids, or combinations of any of the foregoing.
184 . The method of claim 183 , wherein the pharmaceutical composition comprises a lipid nanoparticle.
185 . The method of any one of claims 96-184 , wherein the cell is a mammalian cell.
186 . The method of claim 185 , wherein the mammalian cell is a somatic cell.
187 . The method of claim 185 , wherein the mammalian cell is a primary cell.
188 . The method of any one of claims 96-185 , wherein the cell is an immune cell.
189 . The method of any one of claims 96-188 , wherein the contacting is performed in vitro.
190 . The method of any one of claims 96-188 , wherein the contacting is performed in vivo.
191 . The method of any one of claims 96-188 , wherein the contacting is performed ex vivo.
192 . The method of claim 191 , further comprising administering the cell to a subject.
193 . The method of any one of claims 96-192 , wherein the cell is within a subject.
194 . The method of claim 192 or 193 , wherein the subject has a disease associated with CXCL9, CXCL10, and/or CXCL11.
195 . The method of claim 194 , wherein the disease associated with CXCL9, CXCL10, and/or CXCL11 is selected from the group consisting of acute and chronic liver disease, alagille syndrome, autoimmune hepatitis, biliary atresia, cirrhosis, endoscopic retrograde cholangiopancreatography (ERCP), hemochromatosis, hepatitis A, hepatitis B, alopecia areata, multiple sclerosis, chronic pain, and Human T-lymphotropic virus type 1 (HTLV-1)-associated myelopathy/tropical spastic paraparesis (HAM/TSP).
196 . A method for treating a subject having a disease associated with CXCL9, CXCL10, and/or CXCL11, comprising administering to the subject a therapeutically effective amount of at least one epigenetic modifying agent, each epigenetic modifying agent comprising at least one site-specific targeting moiety which targets a target sequence in an expression control region of human CXCL9, CXCL10, or CXCL11, and an effector molecule, thereby treating the subject.
197 . A method for decreasing T cell migration in a subject having a disease, comprising administering to the subject a therapeutically effective amount of at least one epigenetic modifying agent, each epigenetic modifying agent comprising at least one site-specific targeting moiety which targets a target sequence in an expression control region of human CXCL9, CXCL10, or CXCL11, and an effector molecule, thereby decreasing T cell migration the subject.
198 . The method of claim 197 , wherein T cell migration is decreased in the subject is reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, or at least 70% compared to prior to administering the at least one epigenetic modifying agent to the subject.
199 . The method of claim 197 or 198 , wherein T cell migration is decreased in the subject is reduced by between about 10% to about 70%, about 10% to about 65%, about 10% to about 60%, about 10% to about 55%, about 10% to about 50%, about 10% to about 45%, about 10% to about 40%, about 10% to about 35%, about 10% to about 30%, about 10% to about 25%, about 10% to about 20%, about 10% to about 15%, about 15% to about 70%, about 15% to about 65%, about 15% to about 60%, about 15% to about 55%, about 15% to about 50%, about 15% to about 45%, about 15% to about 40%, about 15% to about 35%, about 15% to about 30%, about 15% to about 25%, about 15% to about 20%, about 20% to about 70%, about 20% to about 65%, about 20% to about 60%, about 20% to about 55%, about 20% to about 50%, about 20% to about 45%, about 20% to about 40%, about 20% to about 35%, about 20% to about 30%, about 20% to about 25%, about 25% to about 70%, about 25% to about 65%, about 25% to about 60%, about 25% to about 55%, about 25% to about 50%, about 25% to about 45%, about 25% to about 40%, about 25% to about 35%, about 25% to about 30%, about 30% to about 70%, about 30% to about 65%, about 30% to about 60%, about 30% to about 55%, about 30% to about 50%, about 30% to about 45%, about 30% to about 40%, about 30% to about 35%, about 35% to about 70%, about 35% to about 65%, about 35% to about 60%, about 35% to about 55%, about 35% to about 50%, about 35% to about 45%, about 35% to about 40%, about 40% to about 70%, about 40% to about 65%, about 40% to about 60%, about 40% to about 55%, about 40% to about 50%, about 40% to about 45%, about 45% to about 70%, about 45% to about 65%, about 45% to about 60%, about 45% to about 55%, about 45% to about 50%, about 50% to about 70%, about 50% to about 65%, about 50% to about 60%, about 50% to about 55%, about 55% to about 70%, about 55% to about 65%, about 55% to about 60%, about 60% to about 70%, about 60% to about 65%, or about 65% to about 70% compared to prior to administering the at least one epigenetic modifying agent to the subject.
200 . The epigenetic modifying agent of any one of claims 196-199 , wherein the target sequence is within a human chromosomal region selected from the group consisting of chr4: 76928543-76931536, chr4: 76944524-76948668, chr4: 76957098-76962383, chr4: 76949523-76949873, chr4: 76932906-76933929, chr4: 76916900-76917300, chr4: 76988761-76989260, chr4: 77008274-77008727, and chr4: 76957852-76958551.
201 . The epigenetic modifying agent of any one of claims 196-199 , wherein the target sequence is located within about 100 bp, about 200 bp, about 300 bp, about 400 bp, about 450 bp, about 500 bp, about 550 bp, about 600 bp, about 650 bp, about 700 bp, about 750 bp, about 800 bp, about 850 bp, about 900 bp, about 950 bp, about 1 kb, about 1.1 kb, about 1.2 kb, about 1.3 kb, about 1.4 kb, about 1.5 kb, about 1.6 kb, about 1.7 kb, about 1.8 kb, about 1.9 kb, about 2.0 kb, about 2.1 kb, about 2.2 kb, about 2.3 kb, about 2.4 kb, about 2.5 kb, about 2.6 kb, about 2.7 kb, about 2.8 kb, about 2.9 kb, or about 3.0 kb from a human chromosomal region selected from the group consisting of chr4: 76958201-76958221, chr4: 76949758-76949778, chr4: 76933245-76933265, chr4: 76932967-76932987, chr4: 76957115-76957132, chr4: 76944734-76944751, chr4: 76944656-76944673, and chr4: 76933040-76933057.
202 . The epigenetic modifying agent of any one of claims 196-200 , wherein the target sequence comprises a sequence selected from the group consisting of AGCCATGACACTGCACTACCC (SEQ ID NO: 422), ATTCTGCACCAGCTGAGGGGA (SEQ ID NO: 423), GATCCAAATGCTAATGTAACC (SEQ ID NO: 424), GCATGACAAGTTCCTAAACGA (SEQ ID NO: 425), GAAGGGCATGGCTATAGC (SEQ ID NO: 429), GACTTAGCAAAACCTGCT (SEQ ID NO: 430), GGCACACTAGCCCCACGT (SEQ ID NO: 431), and GCAACGATCAATGGGATT (SEQ ID NO: 432).
203 . The method of any one of claims 196-202 , wherein the disease associated with CXCL9, CXCL10, and/or CXCL11 is selected from the group consisting of acute and chronic liver disease, alagille syndrome, autoimmune hepatitis, biliary atresia, cirrhosis, endoscopic retrograde cholangiopancreatography (ERCP), hemochromatosis, hepatitis A, hepatitis B, alopecia areata, multiple sclerosis, chronic pain, and Human T-lymphotropic virus type 1 (HTLV-1)-associated myelopathy/tropical spastic paraparesis (HAM/TSP) and the epigenetic modifying agent reduces expression of CXCL9, CXCL10, or CXCL11 in the subject.
204 . The method of any one of claims 196-203 , wherein the epigenetic modifying agent and the effector molecule are administered to the subject concurrently.
205 . The method of any one of claims 196-203 , wherein the epigenetic modifying agent and the effector molecule are administered to the subject sequentially.
206 . The method of claim 205 , wherein the effector molecule is administered to the subject prior to administration of the epigenetic modifying agent.
207 . The method of claim 205 , wherein the epigenetic modifying agent is administered to the subject prior to administration of the effector molecule.
208 . An epigenetic modifying agent, comprising at least one site-specific targeting moiety which targets a target sequence within an expression control region of human CXCL9, CXCL10, or CXCL11, wherein the target sequence is within a human chromosomal region selected from the group consisting of chr4: 76928543-76931536, chr4: 76944524-76948668, chr4: 76957098-76962383, chr4: 76949523-76949873, chr4: 76932906-76933929, chr4: 76916900-76917300, chr4: 76988761-76989260, chr4: 77008274-77008727, and chr4: 76957852-76958551.
209 . The epigenetic modifying agent of claim 208 , wherein the target sequence comprises a sequence selected from the group consisting of AGCCATGACACTGCACTACCC (SEQ ID NO: 422), ATTCTGCACCAGCTGAGGGGA (SEQ ID NO: 423), GATCCAAATGCTAATGTAACC (SEQ ID NO: 424), GCATGACAAGTTCCTAAACGA (SEQ ID NO: 425), GAAGGGCATGGCTATAGC (SEQ ID NO: 429), GACTTAGCAAAACCTGCT (SEQ ID NO: 430), GGCACACTAGCCCCACGT (SEQ ID NO: 431), and GCAACGATCAATGGGATT (SEQ ID NO: 432).
210 . The epigenetic modifying agent of claim 208 or 209 , wherein the site-specific targeting moiety comprises a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide identity to the entire nucleotide sequence of any of the nucleotide sequences in any one of Table 3 or Table 5.
211 . The epigenetic modifying agent of any one of claims 208-210 , wherein the site-specific targeting moiety comprises a polymeric molecule comprising a polynucleotide encoding a DNA-binding domain of a Transcription activator-like effector (TALE) polypeptide or a zinc finger (ZFP) polypeptide, or fragment thereof, that specifically binds to the expression control region of CXCL9, CXCL10, or CXCL11.
212 . The epigenetic modifying agent of claim 210 , wherein the DNA-binding domain of the ZFP or TALE polypeptide comprises an amino acid sequence having at least about 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid identity to the entire amino acid sequence of any one of the amino acid sequences listed in Table 3 or Table 5.
213 . The epigenetic modifying agent of claim 208 , wherein the expression control region comprises a nucleotide sequence of a ZF05 target sequence (SEQ ID NO: 407).
214 . The epigenetic modifying agent of claim 208 , wherein the expression control region comprises a nucleotide sequence of a ZF07 target sequence (SEQ ID NO: 405).
215 . The epigenetic modifying agent of claim 208 , wherein the expression control region comprises a nucleotide sequence of a ZF16 target sequence (SEQ ID NO: 403).
216 . The epigenetic modifying agent of claim 208 , wherein the expression control region comprises a nucleotide sequence of a ZF24 target sequence (SEQ ID NO: 401).
217 . The epigenetic modifying agent of claim 208 , wherein the expression control region comprises a nucleotide sequence of a TAL08 target sequence (SEQ ID NO: 419).
218 . The epigenetic modifying agent of claim 208 , wherein the expression control region comprises a nucleotide sequence of a TAL14 target sequence (SEQ ID NO: 415).
219 . The epigenetic modifying agent of claim 208 , wherein the expression control region comprises a nucleotide sequence of a TAL04 target sequence (SEQ ID NO: 421).
220 . The epigenetic modifying agent of claim 208 , wherein the expression control region comprises a nucleotide sequence of a TAL09 target sequence (SEQ ID NO: 417).
221 . An epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of ZF05-MQ1 comprising the amino acid sequence of (SEQ ID NO: 466).
222 . An epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of ZF07-MQ1 comprising the amino acid sequence of (SEQ ID NO: 465).
223 . An epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of ZF05-KRAB comprising the amino acid sequence of (SEQ ID NO: 467).
224 . An epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of ZF07-KRAB comprising the amino acid sequence of (SEQ ID NO: 461).
225 . An epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of ZF24-KRAB comprising the amino acid sequence of (SEQ ID NO: 463).
226 . An epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of ZF16-KRAB comprising the amino acid sequence of (SEQ ID NO: 464).
227 . An epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of TAL08-KRAB comprising the amino acid sequence of (SEQ ID NO: 470).
228 . An epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of a TAL14-KRAB comprising the amino acid sequence of (SEQ ID NO: 468).
229 . An epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of a TAL04-KRAB comprising the amino acid sequence of (SEQ ID NO: 471).
230 . An epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of a TAL09-KRAB comprising the amino acid sequence of (SEQ ID NO: 469).
231 . An epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of a ZF05-KRAB-tPT2A-TAL14-KRAB comprising the amino acid sequence of (SEQ ID NO: 474).
232 . A vector comprising a nucleic acid molecule encoding the epigenetic modifying agent of any one of claims 221-231 .
233 . The vector of claim 232 , wherein the vector is a viral expression vector.
234 . A pharmaceutical composition comprising the epigenetic modifying agent of any one of claims 221-231 , or the vector of claim 232 or 233 .
235 . The pharmaceutical composition of claim 234 , wherein the pharmaceutical composition comprises a lipid formulation.
236 . The pharmaceutic composition of claim 235 , wherein the lipid formulation comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, or one or more PEG-modified lipids, or combinations of any of the foregoing.
237 . The pharmaceutical composition of claim 235 , wherein the pharmaceutical composition comprises a lipid nanoparticle.
238 . A pharmaceutical composition, comprising an epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of ZF05-MQ1 comprising the amino acid sequence of (SEQ ID NO: 466); and a lipid nanoparticle.
239 . A pharmaceutical composition, comprising an epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of ZF07-MQ1 comprising the amino acid sequence of (SEQ ID NO: 465); and a lipid nanoparticle.
240 . A pharmaceutical composition, comprising an epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of a ZF05-KRAB comprising the amino acid sequence of (SEQ ID NO: 467); and a lipid nanoparticle.
241 . A pharmaceutical composition, comprising an epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of a ZF07-KRAB comprising the amino acid sequence of (SEQ ID NO: 461); and a lipid nanoparticle.
242 . A pharmaceutical composition, comprising an epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of a ZF24-KRAB comprising the amino acid sequence of (SEQ ID NO: 463); and a lipid nanoparticle.
243 . A pharmaceutical composition, comprising an epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of a ZF16-KRAB comprising the amino acid sequence of (SEQ ID NO: 464); and a lipid nanoparticle.
244 . A pharmaceutical composition, comprising an epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of a TAL08-KRAB comprising the amino acid sequence of (SEQ ID NO: 470); and a lipid nanoparticle.
245 . A pharmaceutical composition, comprising an epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of a TAL14-KRAB comprising the amino acid sequence of (SEQ ID NO: 468); and a lipid nanoparticle.
246 . A pharmaceutical composition, comprising an epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of a TAL04-KRAB comprising the amino acid sequence of (SEQ ID NO: 471); and a lipid nanoparticle.
247 . A pharmaceutical composition, comprising an epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of a TAL09-KRAB comprising the amino acid sequence of (SEQ ID NO: 469); and a lipid nanoparticle.
248 . A pharmaceutical composition, comprising an epigenetic modifying agent, comprising a polynucleotide encoding the amino acid sequence of a ZF05-KRAB-tPT2A-TAL14-KRAB comprising the amino acid sequence of (SEQ ID NO: 474); and a lipid nanoparticle.
249 . A cell comprising the epigenetic modifying agent of any one of claims 221-231 , or the vector of claim 232 or 233 .
250 . A method of reducing expression of CXCL9, CXCL10, or CXCL11 in a cell, the method comprising contacting the cell with an epigenetic modifying agent of any one of claims 221-231 , or the vector of claim 232 or 233 , or the pharmaceutical composition of any one claims 234-248 .
251 . The method of claim 250 , wherein the expression of CXCL9, CXCL10, or CXCL11 in the cell is reduced by at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% compared to prior to contacting the cell with the at least one epigenetic modifying agent.
252 . The method of claim 250 or 251 , wherein the expression of CXCL9, CXCL10, or CXCL11 in the cell is reduced between about 30% to about 100%, about 30% to about 95%, about 30% to about 90%, about 30% to about 85%, about 30% to about 80%, about 30% to about 75%, about 30% to about 70%, about 30% to about 65%, about 30% to about 60%, about 30% to about 55%, about 30% to about 50%, about 30% to about 45%, about 30% to about 40%, about 35% to about 100%, about 35% to about 95%, about 35% to about 90%, about 35% to about 85%, about 35% to about 80%, about 35% to about 75%, about 35% to about 70%, about 35% to about 65%, about 35% to about 60%, about 35% to about 55%, about 35% to about 50%, about 35% to about 45%, about 40% to about 100%, about 40% to about 95%, about 40% to about 90%, about 40% to about 85%, about 40% to about 80%, about 40% to about 75%, about 40% to about 70%, about 40% to about 65%, about 40% to about 60%, about 40% to about 55%, about 40% to about 50%, about 40% to about 45%, about 45% to about 100%, about 45% to about 95%, about 45% to about 90%, about 45% to about 85%, about 45% to about 80%, about 45% to about 75%, about 45% to about 70%, about 45% to about 65%, about 45% to about 60%, about 45% to about 55%, about 45% to about 50%, about 50% to about 100%, about 50% to about 95%, about 50% to about 90%, about 50% to about 85%, about 50% to about 80%, about 50% to about 75%, about 50% to about 70%, about 50% to about 65%, about 50% to about 60%, about 50% to about 55%, about 55% to about 100%, about 55% to about 95%, about 55% to about 90%, about 55% to about 85%, about 55% to about 80%, about 55% to about 75%, about 55% to about 70%, about 55% to about 65%, about 55% to about 60%, about 60% to about 100%, about 60% to about 95%, about 60% to about 90%, about 60% to about 85%, about 60% to about 80%, about 60% to about 75%, about 60% to about 70%, about 60% to about 65%, about 65% to about 100%, about 65% to about 95%, about 65% to about 90%, about 65% to about 85%, about 65% to about 80%, about 65% to about 75%, about 65% to about 70%, about 70% to about 100%, about 70% to about 95%, about 70% to about 90%, about 70% to about 85%, about 70% to about 80%, about 70% to about 75%, about 75% to about 100%, about 75% to about 95%, about 75% to about 90%, about 75% to about 85%, about 75% to about 80%, about 80% to about 100%, about 80% to about 95%, about 80% to about 90%, about 80% to about 85%, about 85% to about 100%, about 85% to about 95%, about 85% to about 90%, about 90% to about 100%, about 90% to about 95%, or about 95% to about 100% compared to prior to contacting the cell with the at least one epigenetic modifying agent.