Methods of modulating an immune response using immunostimulatory sequences and compositions for use therein
The invention provides methods of modulating an immune response to a second antigen which entail administration of a first antigen and an immunostimulatory polynucleotide. Modulation of the immune response is generally manifested as stimulation of a Th1 response.
1. A method of modulating an immune response to a second antigen in an individual, comprising co-administering to the individual
(i) a complex comprising an immunomodulatory polynucleotide proximately associated with a first antigen by encapsulation, adsorption onto a surface or linkage to a platform molecule, and
(ii) a second antigen that is not part of the complex,
wherein the polynucleotide comprises an immunostimulatory sequence (ISS) comprising the sequence 5′-cytosine, guanine-3′, wherein the complex and the second antigen are administered at the same site in the individual and at the same time in an amount sufficient to modulate an immune response in the individual to the second antigen.
2. The method of claim 1 , wherein the immunomodulatory polynucleotide and first antigen are proximately associated by linkage to a platform molecule.
3. The method of claim 1 , wherein the immunomodulatory polynucleotide and first antigen are proximately associated by encapsulation.
4. The method of claim 1 , wherein the immunomodulatory polynucleotide and first antigen are are proximately associated by adsorption onto a surface.
5. The method of claim 1 , wherein the first antigen is an allergen.
6. The method of claim 1 , wherein the first antigen is a conserved polypeptide of a virus.
7. The method of claim 6 , wherein the conserved viral polypeptide is influenza nucleocapsid protein.
8. The method of claim 6 , wherein the conserved viral polypeptide is human immunodeficiency virus (HIV) gag protein.
9. The method of claim 1 , wherein the first antigen is a carrier molecule.
10. The method of claim 9 , wherein the carrier molecule is diphtheria toxin mutant (CRM 197).
11. The method of claim 9 , wherein the carrier molecule is diphtheria toxoid.
12. The method of claim 1 , wherein the first antigen is associated with a carrier molecule.
13. The method of claim 1 , wherein the immune response is modulated by stimulating a Th1 response to the second antigen.
14. The method of claim 13 , wherein production of Th1-associated antibodies is stimulated.
15. The method of claim 13 , wherein interferon gamma production is stimulated.
16. The method of claim 15 , wherein the ISS comprises the sequence 5′-TCG-3′.
17. The method of claim 15 , wherein the ISS comprises the sequence 5′-purine, purine, C, G, pyrimidine, pyrimidine-3′.
18. The method of claim 17 , wherein the ISS comprises the sequence 5′-AACGTT-3′.
19. The method of claim 17 , wherein the ISS comprises the sequence 5′-purine, purine, C, G, pyrimidine, pyrimidine, C, C-3′.
20. The method of claim 17 , wherein the ISS comprises the sequence 5′-purine, purine, C, G, pyrimidine, pyrimidine, C, G-3′.
21. The method of claim 17 , wherein the ISS comprises a sequence selected from the group consisting of AACGTTCC, AACGTTCG, GACGTTCC, and GACGTTCG.
22. The method of claim 20 , wherein the ISS comprises the sequence TGACTGTGAACGTTCGAGATGA (SEQ ID NO:1).
23. The method of claim 1 , wherein the individual is a mammal.
24. The method of claim 23 , wherein the mammal is human.
25. The method of claim 5 , wherein the allergen is Amb a I.
26. A method of treating an allergy in an individual, comprising co-administering to the individual
(i) a complex comprising an immunomodulatory polynucleotide proximately associated with a first allergen by encapsulation, adsorption onto a surface or linkage to a platform molecule, and
(ii) a second allergen that is not part of the complex,
wherein the polynucleotide comprises an immunostimulatory sequence (ISS) comprising the sequence 5′-cytosine, guanine-3′, wherein the complex and the second allergen are administered at the same site in the individual and at the same time in an amount sufficient to stimulate a Th1 immune response in the individual to the second allergen.
27. The method of claim 26 , wherein the first allergen is Amb a I.
28. A method of vaccinating an individual, comprising co-administering to the individual
(i) a complex comprising an immunomodulatory polynucleotide proximately associated with a first antigen by encapsulation, adsorption onto a surface or linkage to a platform molecule, and
(ii) a second antigen that is not part of the complex,
wherein the polynucleotide comprises an immunostimulatory sequence (ISS) comprising the sequence 5′-cytosine, guanine-3′, wherein the complex and the second antigen are administered at the same site in the individual and at the same time in an amount sufficient to stimulate an immune response in the individual to the second antigen.
29. The method of claim 28 , wherein the first antigen is a conserved polypeptide of a virus.
30. The method of claim 29 , wherein the conserved viral polypeptide is influenza nucleocapsid protein.
31. The method of claim 29 , wherein the conserved viral polypeptide is human immunodeficiency virus (HIV) gag protein.
32. The method of claim 28 , wherein the first antigen is a carrier molecule.
33. The method of claim 32 , wherein the carrier molecule is diphtheria toxin mutant (CRM 197).
34. The method of claim 32 , wherein the carrier molecule is diphtheria toxoid.
35. The method of claim 28 , wherein the first antigen is associated with a carrier molecule.