IP Library Granted Patent US 9,205,143
Granted Patent B2
US 9,205,143 · App. 14/049,842 · Granted Dec 8, 2015

Pneumococcal vaccine and uses thereof

Inventors: Heather Lynn Davis (Ottawa, CA); Arthur Mertz Krieg (Cambridge, MA); Nicolai Lohse (Hvidovre, DK); Lars Ostergaard (Aarhus N, DK); Henrik Carl Schonheyder (Aalborg, DK); Ole Schmeltz Sogaard (Aarhus N, DK)
Assignee: Coley Pharmaceutical Group Inc.
A61K39/092A61K39/385A61K2039/55561A61K2039/6037
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 9,205,143
App. No.
14/049,842
Granted
Dec 8, 2015
Kind
B2
Abstract

The present invention relates to new pneumococcal vaccines. The invention also relates to vaccination of subjects, in particular immunocompromised subjects, against pneumoccocal infections using said novel pneumococcal vaccines.

Claims (24)

1. A method of immunizing a subject against diseases caused by S. pneumoniae infection comprising administering to said subject:

an immunoprotective dose of a vaccine comprising conjugated capsular S. pneumoniae saccharide antigens from serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F; and

at least one TLR-9 agonist as an adjuvant, wherein said at least one TLR-9 agonist is a CpG oligonucleotide having the nucleic acid sequence selected from the group consisting of: 5′ TCGTCGTTTTTCGGTGCTTTT 3′ (SEQ ID NO: 3); 5′ TCGTCGTTTTTCGGTCGTTTT 3′ (SEQ ID NO: 4); 5′ TCGTCGTTTTGTCGTTTTGTCGTT 3′ (SEQ ID NO: 5); 5′ TCGTCGTTTCGTCGTTTTGTCGTT 3′ (SEQ ID NO: 6); and 5′ TCGTCGTTTTGTCGTTTTTTTCGA 3′ (SEQ ID NO: 7);

and wherein said subject suffers from HIV-infection or acquired immunodeficiency syndrome (AIDS).

2. The method of claim 1 , wherein said subject is a mammal.

3. The method of claim 2 , wherein said mammal is a cat, sheep, pig, horse, bovine, dog, rat, mouse or a human.

4. The method according to claim 1 , wherein the subject is a human adult at least 55 years of age.

5. The method of claim 1 , wherein an internucleotide linkage of the CpG oligonucleotide is phosphodiester, phosphorothioate, methylphosphonate, methylphosphorothioate, phosphorodithioate, p-ethoxy, or combinations thereof.

6. The method of claim 1 , wherein the vaccine comprises S. pneumoniae saccharides from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F.

7. The method of claim 1 , wherein the capsular saccharide antigens are conjugated to a carrier protein selected from the group consisting of: TT, DT, CRM197, fragment C of TT, PhtD, PhtDE fusions, detoxified pneumolysin, and protein D.

8. The method of claim 1 , wherein the capsular saccharide antigens are all individually conjugated to the same carrier protein.

9. The method of claim 8 , wherein the carrier protein is CRM197.

10. The method according to claim 1 , wherein said CpG oligonucleotide is selected from the group consisting of:

5′ T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*G*C*T*T*T*T 3′ (SEQ ID NO 8),

5′ T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*C*G*T*T*T*T 3′ (SEQ ID NO 9),

5′ T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3′ (SEQ ID NO 10),

5′ T*C*G*T*C*G*T*T*T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3′ (SEQ ID NO 11), and

5′ T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*T*T*T*C*G*A 3′ (SEQ ID NO: 12),

wherein * refers to a phosphorothioate bond.

11. The method according to claim 1 , wherein the at least one TLR-9 agonist is present in an amount ranging from 0.2 mg to 10 mg.

12. The method according to claim 1 , wherein each conjugate saccharide antigen of the vaccine is present in an amount ranging from 2 to 100 μg.

13. The method according to claim 12 , wherein each saccharide antigen of the vaccine is present in an amount ranging from 1 to 5 μg.

14. The method according to claim 1 , wherein said vaccine comprises sodium chloride and/or sodium succinate buffer as excipient(s).

15. The method according to claim 1 , wherein alum, aluminium hydroxide, aluminium phosphate, or aluminium sulphate is further administered in addition to the at least one TLR-9 agonist as adjuvant.

Assignments (1)
ASSIGNEE ADDRESS CORRECTION Recorded Mar 15, 2023
From: COLEY PHARMACEUTICAL GROUP, INC.
To: COLEY PHARMACEUTICAL GROUP, INC.
Reel/Frame 063100/0388 →
Continuity (4)
Division 13266846
Provisional Application 61238313 · Aug 31, 2009
Provisional Application 61174068 · Apr 30, 2009
Related Publication 20140099337A1 · Apr 10, 2014