Switchable gRNAs comprising aptamers
Some aspects of this disclosure provide compositions, methods, systems, and kits for controlling the activity and/or improving the specificity of RNA-programmable endonucleases, such as Cas9. For example, provided are guide RNAs (gRNAs) that are engineered to exist in an “on” or “off” state, which control the binding and hence cleavage activity of RNA-programmable endonucleases.
1. A switchable single-guide RNA (sgRNA), comprising
(1) an sgRNA backbone sequence, wherein the sgRNA backbone sequence comprises a nucleotide sequence that is at least 90% identical to the nucleotide sequence 5′- GUUUUAGAGC UAUGCUGAAA AGCAUAGCAA GUUAAAAUAA GGCUAGUCCG UUAUC -3′(nucleotides 79-133 of SEQ ID NO: 6) and/or at least 90% identical to the nucleotide sequence 5′- GUUUUAGAGC UAUGCUGAAA AGCAUAGCAA GUUAAAAU -3′(nucleotides 22-59 of SEQ ID NO: 9);
(2) an RNA aptamer comprising a riboswitch, wherein the aptamer comprises 20-100 nucleotides, and wherein the riboswitch is selected from a theophylline riboswitch, a thiamine pyrophosphate (TPP) riboswitch, an adenosine cobalamin (AdoCbl) riboswitch, an S-adenosyl methionine (SAM) riboswitch, an SAH riboswitch, a flavin mononucleotide (FMN) riboswitch, a tetrahydrofolate riboswitch, a lysine riboswitch, a glycine riboswitch, a purine riboswitch, a GlmS riboswitch, or a pre-queosinel (PreQ1) riboswitch; and
(3) a guide sequence that is complementary to a DNA target site,
wherein the DNA target site comprises the structure 5′-[N z ]-[protospacer adjacent motif (PAM)]-3′, wherein
each N is, independently, any nucleotide, and
Z is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50;
wherein the guide sequence of (3) is flanked by the riboswitch of (2) on one side and by the sgRNA backbone sequence of (1) on the other side; and
wherein the riboswitch of (2) comprises a sequence of at least 4 contiguous nucleotides that is complementary to the guide sequence.
2. A complex comprising a Cas9 protein and the switchable sgRNA of claim 1 .
3. The complex of claim 2 , wherein the sgRNA:ligand:Cas9 complex binds the target DNA.
4. A polynucleotide encoding the switchable sgRNA of claim 1 .
5. A vector comprising a polynucleotide of claim 4 .
6. A vector for recombinant expression comprising a polynucleotide encoding the switchable sgRNA of claim 1 .
7. An isolated cell comprising a genetic construct for expressing the switchable sgRNA of claim 1 .
8. An isolated cell of claim 7 , wherein the cell expresses a Cas9 protein.
9. A method for site-specific DNA cleavage comprising contacting a DNA with a complex comprising (i) the switchable sgRNA of claim 1 wherein the switchable sgRNA comprises a sequence that binds to a portion of the target DNA (ii) a specific ligand bound to the aptamer of the switchable sgRNA, and (iii) a Cas9 protein, under conditions in which the Cas9 protein cleaves the target DNA.
10. The method of claim 9 , wherein the DNA is in a cell.
11. The method of claim 10 , wherein the cell is a eukaryotic cell.
12. The method of claim 11 , wherein the cell is in an individual.
13. The method of claim 12 , wherein the individual is a human.
14. A method for inducing site-specific DNA cleavage in a cell comprising:
(a) contacting a cell or expressing within a cell the switchable sgRNA of claim 1 , wherein the sgRNA comprises a sequence capable of binding to a target DNA;
(b) contacting the cell or expressing within the cell a Cas9 protein; and
(c) contacting the cell with a specific ligand that binds the aptamer of the sgRNA, resulting in the formation of a sgRNA:ligand:Cas9 complex that cleaves the target DNA.
15. A method for inducing site-specific DNA cleavage in a cell comprising (a) contacting the cell with a complex comprising a Cas9 protein and the switchable sgRNA of claim 1 , wherein the sgRNA comprises a sequence capable of binding to a DNA target sequence, and (b) contacting the cell with a specific ligand that binds the aptamer of the sgRNA, resulting in the formation of a sgRNA:ligand:Cas9 complex that cleaves the DNA target.
16. The method of claim 15 , wherein steps (a) and (b) are performed simultaneously or sequentially in any order.
17. The method of claim 14 , wherein the cell is in an individual.
18. The switchable sgRNA of claim 1 , wherein the aptamer comprises a nucleotide sequence of 4 contiguous nucleotides that are complementary to the guide sequence.
19. The switchable sgRNA of claim 1 , wherein the riboswitch is a theophylline riboswitch.
20. The switchable sgRNA of claim 19 , wherein the theophylline riboswitch comprises SEQ ID NO:3.
21. The switchable sgRNA of claim 19 , wherein the riboswitch comprises the sequence 5′- GGUGAUACCAGCAUCGUCUUGAUGCCCUUGGCAGCACC - 3′(SEQ ID NO:3), wherein the underlined, bold portion of SEQ ID NO:3 is modified by replacing, deleting, or adding 1 or more nucleotides to include the sequence of at least 4 contiguous nucleotides that is complementary to the guide sequence of (3).
22. The switchable sgRNA of claim 19 , wherein the guide sequence of (3) is flanked by the riboswitch of (2) on the 5′side and by the sgRNA backbone sequence of (1) on the 3′side.