Construction of bifunctional short hairpin RNA

1. A bifunctional shRNA made by a method comprising:

designing a bi-shRNA expression cassette encoding a bi-shRNA comprising:

selecting one or more first target site sequences of a targeted species, wherein the one or more first target site sequences have low homology with other mRNAs of the targeted species, wherein low homology is selected from the group consisting of less than 75%, less than 80%, less than 90%, less than 95%, and less than 98% homology;

selecting one or more second target site sequences of a targeted species, wherein the one or more second target site sequences have low homology with other mRNAs of the targeted species, wherein low homology is selected from the group consisting of less than 75%, less than 80%, less than 90%, less than 95%, and less than 98% homology;

providing a backbone sequence comprising a first and a second stem-loop structure, wherein the first stem-loop structure comprises two first insertion sites linked by a first loop sequence within the first stem and wherein the second stem-loop structure comprises two second insertion sites linked by a second loop sequence within the second stem; wherein the first and the second stem-loop structures are linked by a sequence longer than 5 nucleotides;

inserting a first passenger strand and a first guide strand into the two first insertion sites to form the first stem, wherein the first passenger strand is homologous to the one or more first target site sequences and wherein the first guide strand is complementary to the first passenger strand, or wherein the first passenger strand is identical to the reverse orientation of the first guide strand; and

inserting a second passenger strand and a second guide strand into the two second insertion sites to form the second stem-loop structure, wherein either the second passenger strand or the second guide strand is homologous with the one or more first target site sequences, or wherein either the second passenger strand or the second guide strand is homologous with the one or more second target sites sequences, wherein the second passenger strand and the second guide strand are partially complementary, wherein partially complementary is defined has having 1, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, or 1-10 nucleotide mismatches when paired.

2. The bifunctional shRNA of claim 1 , wherein the first stem-loop structure and the second stem-loop structure each comprise a loop of 6-15 nucleotides in size.

3. The bifunctional shRNA of claim 1 , wherein the first stem-loop structure and the second stem-loop structure are each 40 to 100 nucleotides long.

4. The bifunctional shRNA of claim 1 , wherein the first stem-loop structure and the second stem-loop structure are each 50 to 75 nucleotides long.

5. The bifunctional shRNA of claim 1 , wherein the first stem-loop structure and the second stem-loop structure each comprise a stem of 19-45 nucleotides in size.

6. The bifunctional shRNA of claim 1 , wherein the first stem-loop structure and the second stem-loop structure each comprise a stem of 20-30 nucleotides in size.

7. The bifunctional shRNA of claim 1 , wherein at least one passenger strand and one guide strand are 16-19 nucleotides long.

8. The bifunctional shRNA of claim 1 , wherein at least one passenger strand and one guide strand are 19-22 nucleotides long.

9. The bifunctional shRNA of claim 1 , wherein the first loop and the second loop are identical.

10. The bifunctional shRNA of claim 1 , wherein the first loop encodes the sequence AGUGAAGCCACAGAUGU SEQ ID NO:1.

11. The bifunctional shRNA of claim 1 , wherein the backbone sequence comprises the following sequence upstream of the first passenger strand and within the first stem: UUGACAGUGAGCGCC SEQ ID NO:3; and wherein the backbone sequence comprises the following sequence downstream of the first guide strand and within the first stem: GUUGCCUACUGCCUCGG SEQ ID NO:4.

12. The bifunctional shRNA of claim 1 , wherein the backbone sequence comprises the following sequence upstream of the second passenger strand and within the second stem: GCUGUUGACAGUGAGCGCC SEQ ID NO:5; and wherein the backbone sequence comprises the following sequence downstream of the second guide strand and within the second stem: GUUGCCUACUGCCUCGGAAGC SEQ ID NO:6.

13. The bifunctional shRNA of claim 1 , wherein the one or more nucleotide mismatches are located at nucleotide position 9, 10, and 11.

14. The bifunctional shRNA of claim 1 , further comprising determining a ΔG free energy of the second stem loop structure and introducing additional mismatches at the 3′ half of the second passenger strand if ΔG free energy is beyond about −10 Kcal·mole-1.

15. The bifunctional shRNA of claim 1 , wherein the bi-shRNA expression cassette further comprises a lead transcript upstream of the stem-loop structures, wherein the lead transcript is characterized in that it is at least 30 nucleotides or longer in lengths and does not interfere with transcription of the bi-shRNA expression cassette.

16. The bifunctional shRNA of claim 1 , further comprising the steps of:

designing at least three bi-shRNA expression cassettes for the same gene; and

comparing knockdown efficiency of the at least three bi-shRNA expression cassettes by in vitro assessment.

17. The bifunctional shRNA of claim 1 , further comprising operably linking the bi-shRNA expression cassette to a promoter, wherein the second stem-loop structure is upstream in relation to the first stem loop structure, or wherein the first stem-loop structure is upstream in relation to the second stem loop structure.

18. The bifunctional shRNA of claim 1 , further comprising integrating the bi-shRNA expression cassette into genomic DNA, wherein the genomic DNA is selected from the group comprising animal DNA, insect DNA, plant DNA, algae DNA, fungus DNA, yeast DNA, bacteria DNA, and human DNA.

19. The bifunctional shRNA of claim 1 , further comprising inserting the bi-shRNA expression cassette into an expression vector.

20. The bifunctional shRNA of claim 19 , wherein the expression vector comprises a 5′UTR and an intron.

21. The bifunctional shRNA of claim 19 , wherein the expression vector comprises a RNA polymerase II promoter operably linked to the expression of the bi-shRNA expression cassette.

22. The bifunctional shRNA of claim 1 , wherein the backbone sequence comprises a miR30a backbone sequence.

23. The bifunctional shRNA of claim 1 , wherein selecting one or more target site sequences comprises searching by BLAST to find target sites with lowest homology hits to other mRNA of the targeted species.

24. The bifunctional shRNA of claim 1 , wherein providing for synthesis is selected from the group comprising assembling multiple overlapping DNA oligonucleotides, synthesizing a polynucleotide, and combinations thereof.

25. The bifunctional shRNA of claim 1 , wherein providing for synthesis comprises designing DNA oligonucleotides from both strands having an overlap, wherein the overlap is at least four nucleotides.

26. The bifunctional shRNA of claim 1 , further comprising preparing a DNA-DOTAP:Chol Lipoplex.

27. The bifunctional shRNA of claim 1 , wherein the one or more first target site sequences are identical to the second one or more target site sequences.

28. The bifunctional shRNA of claim 1 , wherein the one or more first target site sequences and the one or more second target site sequence are not identical and located on a same transcript of the targeted species.

29. The bifunctional shRNA of claim 1 , wherein the one or more first target site sequences and the one or more second target site sequence are not identical and located within the same gene of the targeted species.

30. The bifunctional shRNA of claim 1 , further comprising transcribing the bi-shRNA expression cassette.

31. The bifunctional shRNA of claim 1 , wherein the bi-shRNA expression cassette is integrated into genomic DNA.

32. The bifunctional shRNA of claim 1 , further comprising integrating the bi-shRNA expression cassette into a crop genomic DNA, wherein crop is a non-animal species or variety that is grown to be harvested as food, livestock fodder, fuel or for any other economic purpose.

33. The bifunctional shRNA of claim 1 , further comprising the step of providing for synthesis of the bi-shRNA expression cassette.

34. The bifunctional shRNA of claim 1 , wherein the targeted species comprises a human, a plant, or an animal nucleic acid sequence.

35. A method for designing a bi-shRNA expression cassette encoding a bi-shRNA comprising:

selecting one or more first target site sequences of a targeted species, wherein the one or more first target site sequences have low homology with other mRNAs of the targeted species;

selecting one or more second target site sequences of a targeted species, wherein the one or more second target site sequences have low homology with other mRNAs of the targeted species;

providing a backbone sequence comprising a first and a second stem-loop structure, wherein the first stem-loop structure comprises two first insertion sites linked by a first loop sequence within the first stem and wherein the second stem-loop structure comprises two second insertion sites linked by a second loop sequence within the second stem; wherein the first and the second stem-loop structures are linked by a sequence longer than 5 nucleotides;

inserting a first passenger strand and a first guide strand into the two first insertion sites to form the first stem, wherein the first passenger strand is homologous to the one or more first target site sequences and wherein the first guide strand is complementary to the first passenger strand, or wherein the first passenger strand is identical to the reverse orientation of the first guide strand; and

inserting a second passenger strand and a second guide strand into the two second insertion sites to form the second stem-loop structure, wherein either the second passenger strand or the second guide strand is homologous with the one or more first target site sequences, or wherein either the second passenger strand or the second guide strand is homologous with the one or more second target sites sequences, wherein the second passenger strand and the second guide strand are partially complementary, wherein partially complementary is defined has having 1, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10 or greater nucleotide mismatches when paired.