IP Library Granted Patent US 9,434,948
Granted Patent B2
US 9,434,948 · App. 14/852,264 · Granted Sep 6, 2016

Multiple exon skipping compositions for DMD

Inventors: Peter Sazani (Bothell, WA); Ryszard Kole (Bellevue, WA)
Assignee: Sarepta Therapeutics, Inc.
C12N15/113C12N15/111C12N2310/11C12N2310/321C12N2310/3233C12N2310/331C12N2310/3341C12N2310/3513C12N2320/30C12N2320/33
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 9,434,948
App. No.
14/852,264
Granted
Sep 6, 2016
Kind
B2
Abstract

Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy.

Claims (8)

1. An antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO:285), in which thymine bases are uracil bases, wherein the antisense oligonucleotide is a 2′-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof.

2. An antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO:285), in which: (i) thymine bases are uracil bases and (ii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof.

3. An antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO:285), in which: (i) thymine bases are uracil bases and (ii) one or more of the bases are hypoxanthine, wherein the antisense oligonucleotide is a 2′-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof.

4. An antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO:285), in which: (i) thymine bases are uracil bases, (ii) one or more of the bases are hypoxanthine, and (iii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof.

5. A pharmaceutical composition comprising an antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO: 285), in which thymine bases are uracil bases, wherein the antisense oligonucleotide is a 2′-O- methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

6. A pharmaceutical composition comprising an antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO: 285), in which: (i) thymine bases are uracil bases and (ii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

7. A pharmaceutical composition comprising an antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO: 285), in which: (i) thymine bases are uracil bases and (ii) one or more of the bases are hypoxanthine, wherein the antisense oligonucleotide is a 2′-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

8. A pharmaceutical composition comprising an antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO: 285), in which: (i) thymine bases are uracil bases, (ii) one or more of the bases are hypoxanthine, and (iii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

Assignments (2)
SECURITY INTEREST Recorded May 7, 2025
From: SAREPTA THERAPEUTICS, INC.
To: JPMORGAN CHASE BANK, N.A. AS ADMINISTRATIVE AGENT
Reel/Frame 071218/0445 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Oct 7, 2015
From: SAZANI, PETER; KOLE, RYSZARD
To: SAREPTA THERAPEUTICS, INC.
Reel/Frame 036750/0844 →
Continuity (4)
Continuation 14523610 · Oct 24, 2014
Division 12605276 · Oct 23, 2009
Provisional Application 61108416 · Oct 24, 2008
Related Publication 20150376618A1 · Dec 31, 2015