Multiple exon skipping compositions for DMD
Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy.
1. An antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO:285), in which thymine bases are uracil bases, wherein the antisense oligonucleotide is a 2′-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof.
2. An antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO:285), in which: (i) thymine bases are uracil bases and (ii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof.
3. An antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO:285), in which: (i) thymine bases are uracil bases and (ii) one or more of the bases are hypoxanthine, wherein the antisense oligonucleotide is a 2′-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof.
4. An antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO:285), in which: (i) thymine bases are uracil bases, (ii) one or more of the bases are hypoxanthine, and (iii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof.
5. A pharmaceutical composition comprising an antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO: 285), in which thymine bases are uracil bases, wherein the antisense oligonucleotide is a 2′-O- methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
6. A pharmaceutical composition comprising an antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO: 285), in which: (i) thymine bases are uracil bases and (ii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
7. A pharmaceutical composition comprising an antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO: 285), in which: (i) thymine bases are uracil bases and (ii) one or more of the bases are hypoxanthine, wherein the antisense oligonucleotide is a 2′-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
8. A pharmaceutical composition comprising an antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO: 285), in which: (i) thymine bases are uracil bases, (ii) one or more of the bases are hypoxanthine, and (iii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.