Antibodies directed against ICOS and uses thereof
The present invention provides antibodies directed against ICOS or a derivative thereof which neutralize ICOS engagement on Treg by inhibiting the fixation between ICOS and ICOS-L and abrogate proliferation of Treg induced by plasmacytoid dendritic cells. The present invention further provides antibodies directed against ICOS or a derivative thereof which induce IL-10 and IFNγ production, induce CD4+ T cells proliferation, reduce Tconv proliferation, and increase the immunosuppressive function of Treg.
1. A method of treatment of cancer in a patient in need thereof, the method comprising administering to the patient an antibody directed against human Inducible T-cell costimulator (ICOS), wherein said antibody competes for binding to human ICOS with an antibody having the following 6 CDRs:
(SEQ ID NO: 7, H-CDR1)
GYTFTTYWMH;
(SEQ ID NO: 8, H-CDR2)
EIDPSDSYVNYNQNFKG;
(SEQ ID NO: 9, H-CDR3)
FDY;
(SEQ ID NO: 10, L-CDR1)
RSSKSPLHSNGNIYLY;
(SEQ ID NO: 11, L-CDR2)
RMSNLAS;
(SEQ ID NO: 12, L-CDR3)
MQHLEYPYT.
2. The method of treatment according to claim 1 , wherein the nucleotide sequences encoding the 6 CDRs are:
(SEQ ID NO: 1, H-CDR1)
GGCTACACCTTCACCACCTACTGGATGCAC;
(SEQ ID NO: 2, H-CDR2)
GAGATTGATCCTTCTGATAGTTATGTTAACTACAATCAAAACTTTAAGGG
C;
(SEQ ID NO: 3, H-CDR3)
TTTGATTAC;
(SEQ ID NO: 4, L-CDR1)
AGGTCTAGTAAGAGTCCCCTGCATAGTAACGGCAACATTTACTTATAT;
(SEQ ID NO: 5, L-CDR2)
CGGATGTCCAACCTTGCCTCA;
(SEQ ID NO: 6, L-CDR3)
ATGCAACATCTAGAATATCCGTACACG.
3. The method of treatment according to claim 1 , wherein said cancer is human malignant lymphoma.
4. The method of treatment according to claim 1 , wherein said cancer is ovarian cancer.
5. The method of treatment according to claim 1 , wherein said cancer is cervical cancer.
6. The method of treatment according to claim 1 , wherein said cancer is breast cancer.
7. The method of treatment according to claim 1 , wherein said cancer is colon cancer.
8. The method of treatment according to claim 1 , wherein said cancer is lung cancer.
9. The method of treatment according to claim 1 , wherein said cancer is prostate cancer.
10. The method of treatment according to claim 1 , wherein said cancer is head and neck cancer.
11. The method of treatment according to claim 1 , wherein said cancer is pancreatic cancer.
12. The method of treatment according to claim 1 , wherein said cancer is bladder cancer.
13. The method of treatment according to claim 1 , wherein said cancer is colorectal cancer.
14. The method of treatment according to claim 1 , wherein said cancer is kidney cancer.
15. The method of treatment according to claim 1 , wherein said cancer is stomach cancer.
16. The method of treatment according to claim 1 , wherein said cancer is skin cancer.
17. The method of treatment according to claim 1 , wherein said cancer is esophageal cancer.