Detection of methicillin-resistant
The present methods pertain to amplifying and/or detecting Staphylococcus aureus (“SA”) and methicillin-resistant Staphylococcus aureus (“MRSA”) nucleic acids based on a combined detection of ldh1 as a SA marker and mecA as a MRSA marker. In certain embodiments the methods also pertain to amplifying and/or detecting one or more SCCmec integration sites or bridge regions. Primers and probes are suitable to be used in the present methods to detect SA and MRSA simultaneously in a single reaction or in separate reactions. The amplified nucleic acid can be detected by a variety of state of the art methods, including fluorescence resonance energy transfer (“FRET”), radiolabels, enzyme labels, and the like.
1. A method for detecting a methicillin-resistant Staphylococcus aureus (“MRSA”) in a sample containing nucleic acids, comprising:
amplifying the nucleic acids in the sample; and
detecting nucleic acids in the sample comprising amplified genes, wherein the presence of amplified genes consisting of mecA and ldh1 genes in approximately 1:1 ratio indicates the presence of methicillin-resistant Staphylococcus aureus , and wherein a difference in concentration of the amplified genes consisting of amplified mecA and amplified ldh1 genes indicates a mixed infection of Staphylococcus aureus and a coagulase-negative carrier of mecA in the sample,
wherein the step of amplifying the nucleic acids in the sample comprises:
(a) contacting the sample with a first primer and a second primer having the formula:
5′-(X) n Y-3′ (I),
wherein n is 0 or 1, wherein when n is 1 X represents a 5′ portion of the primers that is non-complementary to the ldh1 gene and X is about 3-30 nucleotides in length, wherein Y represents a 3′ portion of the primers that is complementary to the ldh1 gene, and wherein Y in the first primer comprises SEQ ID NO:4, GGT*GA*ACA*TGGTGACACTGAAT, wherein T* is 5-(4-hydroxy-but-1-ynyl)-1H-pyrimidine-2,4-dione and A* is 4-(4,6-Diamino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)-but-3-yn-1-ol;
(b) contacting the sample after step (a) with a third primer and a fourth primer having the formula:
5′-(X) n Y′-3′ (I),
wherein n is 0 or 1, wherein when n is 1 X represents a 5′ portion of the primers that is non-complementary to the mecA gene and X is about 3-30 nucleotides in length, and wherein Y′ represents a 3′ portion of the primers that is complementary to the mecA gene; and
(c) incubating the sample following steps (a) and (b) under conditions sufficient to amplify the ldh1 and mecA genes.
2. The method of claim 1 , wherein the amplified ldh1 gene comprises SEQ ID NO: 1 and the amplified mecA gene comprises SEQ ID NO:2.
3. The method of claim 1 , wherein the amplifying is continuously monitored during the detecting step.
4. The method of claim 3 , further comprising the step of calculating real time concentrations of amplified mecA and ldh1 genes.
5. The method of claim 1 , wherein the amplified mecA and ldh1 genes are detected by hybridization to mecA or ldh1 specific probes.
6. The method of claim 5 , wherein the probes are fluorescence-generating probes.
7. The method of claim 6 , wherein the ldh1 specific fluorescence-generating probe comprises SEQ ID NO:10, 5′-Ra-G*ACATTACT*T*GA*ACAA*CG-Rb 5′, wherein Ra is (M) a -Fl or (M) a -Q, Rb is (M) a -Fl or (M) a -Q, M is a minor groove binder, a is 0 or 1, Fl is a fluorophore with emission wavelength between about 400 and 900 nm, Q is a non-fluorescent quencher, T* is 5-(4-hydroxy-but-1-ynyl)-1H-pyrimidine-2,4-dione, A* is 4, (4,6-Diamino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)-but-3-yn-1-ol, and G* is 6-amino-1H-pyrazolo[3,4-d]pyrimidin-4(5H)-one, wherein one of Ra and Rb comprises a fluorophore and the other comprises a quencher, and wherein the quencher allows quenching of fluorescence when the probe is unhybridized.
8. The method of claim 6 , wherein the mecA specific fluorescence-generating probe comprises SEQ ID NO:11, 5′-Ra-G*AAAGGATCTGTACTGG*G-Rb 5′, wherein Ra is (M) a -Fl or (M) a -Q, Rb is (M) a -Fl or (M) a -Q, M is a minor groove binder, a is 0 or 1, Fl is a fluorophore with emission wavelength between about 400 and 900 nm, Q is a non-fluorescent quencher, and G* is 6-amino-1H-pyrazolo[3,4-d]pyrimidin-4(5H)-one, wherein one of Ra and Rb comprises a fluorophore and the other comprises a quencher, and wherein the quencher allows quenching of fluorescence when the probe is unhybridized.
9. The method of claim 1 , wherein the primers are fluorescence-generating primers.
10. The method of claim 1 , further comprising the step of detecting nucleic acids in the sample comprising at least one amplified SCCmec integration site or bridge region.
11. The method of claim 1 , further comprising the step of detecting nucleic acids in the sample comprising at least one amplified Staphylococcus aureus (“SA”) specific gene in addition to ldh1.
12. The method of claim 1 , wherein the first primer comprises SEQ ID NO:6, AATAAATCATAAGGT*GA*ACA*TGGTGACACTGAAT, having an underlined first sequence that is non-complementary to the ldh1 gene, wherein T* is 5-(4-hydroxy-but-1-ynyl)-1H-pyrimidine-2,4-dione and A* is 4-(4,6-Diamino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)-but-3-yn-1-ol, and wherein the second primer comprises SEQ ID NO:7, AATAAATCATAAGCGCTTTGCCCTCAGGACG, having an underlined second sequence that is non-complementary to the ldh1 gene.
13. The method of claim 1 , wherein the third primer comprises SEQ ID NO:8, GTGCGTTAATATTGCCATTATTTTCTAATGCG, wherein n is 0, and wherein the fourth primer comprises SEQ ID NO:9, GGTTACGGACAAGGTGAAATAITGATTAACC, wherein n is 0 and I is 3-alkynyl-1H-pyrazolo[3,4-d]pyrimidin-4(5H)-one.
14. A method for detecting a methicillin-resistant Staphylococcus aureus (“MRSA”) in a sample containing nucleic acids, comprising:
amplifying the nucleic acids in the sample; and
detecting nucleic acids in the sample comprising amplified genes, wherein the presence of amplified genes consisting of mecA and Idh1 genes in approximately 1:1 ratio indicates the presence of methicillin-resistant Staphylococcus aureus , and wherein a difference in concentration of the amplified genes consisting of amplified mecA and amplified Idh1 genes indicates a mixed infection of Staphylococcus aureus and a coagulase-negative carrier of mecA in the sample,
wherein the step of amplifying the nucleic acids in the sample comprises:
(a) contacting the sample with a first primer and a second primer having the formula:
5′-(X)nY-3′, wherein n is 1 and X represents a 5′ portion of the primers that is non-complementary to the Idh1 gene and X is about 3-30 nucleotides in length, wherein Y represents a 3′ portion of the primers that is complementary to the Idh1 gene, wherein the first primer comprises SEQ ID NO:6 AATAAATCATAAGGT*GA*ACA*TGGTGACACTGAAT, having an underlined first sequence that is non-complementary to the Idh1 gene, wherein T* is 5-(4-hydroxy-but-1-ynyl)-1H-pyrimidine-2,4-dione and A* is 4-(4,6-Diamino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)-but-3-yn-1-ol, and wherein the second primer comprises SEQ ID NO:7 AATAAATCATAAGCGCTTTGCCCTCAGGACG, having an underlined second sequence that is non-complementary to the Idh1 gene;
(b) contacting the sample after step (a) with a third primer and a fourth primer having the formula: 5′-(X)nY′-3′, wherein n is 0 or 1, wherein when n is 1 X represents a 5′ portion of the primers that is non-complementary to the mecA gene and X is about 3-30 nucleotides in length, and wherein Y′ represents a 3′ portion of the primers that is complementary to the mecA gene; and
(c) incubating the sample following steps (a) and (b) under conditions sufficient to amplify the Idh1 and mecA genes.
15. A method for detecting a methicillin-resistant Staphylococcus aureus (“MRSA”) in a sample containing nucleic acids, comprising:
amplifying the nucleic acids in the sample; and
detecting nucleic acids in the sample comprising amplified genes, wherein the presence of amplified genes consisting of mecA and Idh1 genes in approximately 1:1 ratio indicates the presence of methicillin-resistant Staphylococcus aureus , and wherein a difference in concentration of the amplified genes consisting of amplified mecA and amplified Idh1 genes indicates a mixed infection of Staphylococcus aureus and a coagulase-negative carrier of mecA in the sample, wherein the step of amplifying the nucleic acids in the sample comprises:
(a) contacting the sample with a first primer and a second primer having the formula: 5′-(X)nY-3′, wherein n is 0 or 1, wherein when n is 1 X represents a 5′ portion of the primers that is non-complementary to the Idh1 gene and X is about 3-30 nucleotides in length, wherein Y represents a 3′ portion of the primers that is complementary to the Idh1 gene;
(b) contacting the sample after step (a) with a third primer and a fourth primer complementary to the mecA gene, wherein the third primer comprises SEQ ID NO:8 GTGCGTTAATATTGCCATTATTTTCTAATGCG, and wherein the fourth primer comprises SEQ ID NO: 9 GGTTACGGACAAGGTGAAATAITGATTAACC, wherein I is 3-alkynyl-1H-pyrazolo[3,4-d]pyrimidin-4(5H)-one; and
(c) incubating the sample following steps (a) and (b) under conditions sufficient to amplify the Idh1 and mecA genes.
16. A method for detecting a methicillin-resistant Staphylococcus aureus (“MRSA”) in a sample containing nucleic acids, comprising:
amplifying the nucleic acids in the sample; and
detecting nucleic acids in the sample comprising amplified genes, wherein the presence of amplified genes consisting of mecA and Idh1 genes in approximately 1:1 ratio indicates the presence of methicillin-resistant Staphylococcus aureus , and wherein a difference in concentration of the amplified genes consisting of amplified mecA and amplified Idh1 genes indicates a mixed infection of Staphylococcus aureus and a coagulase-negative carrier of mecA in the sample, wherein the step of amplifying the nucleic acids in the sample comprises:
(a) contacting the sample with a first primer and a second primer having the formula: 5′-(X)nY-3′, wherein n is 0 or 1, wherein when n is 1 X represents a 5′ portion of the primers that is non-complementary to the Idh1 gene and X is about 3-30 nucleotides in length, wherein Y represents a 3′ portion of the primers that is complementary to the Idh1 gene;
(b) contacting the sample after step (a) with a third primer and a fourth primer having the formula: 5′-(X)nY′-3′, wherein n is 0 or 1, wherein when n is 1 X represents a 5′ portion of the primers that is non-complementary to the mecA gene and X is about 3-30 nucleotides in length, and wherein Y′ represents a 3′ portion of the primers that is complementary to the mecA gene; and
(c) incubating the sample following steps (a) and (b) under conditions sufficient to amplify the Idh1 and mecA genes, wherein the amplified mecA and Idh1 genes are detected by hybridization to a mecA specific probe and a Idh1 specific probe, and wherein the Idh1 specific fluorescence-generating probe comprises SEQ ID NO: 10 5′-Ra G*ACATTACT*T*GA*ACAA*CG-Rb 5′, wherein Ra is (M) a -Fl or (M) a -Q, Rb is (M) a -Fl or (M) a -Q, M is a minor groove binder, a is 0 or 1, F1 is a fluorophore with emission wavelength between about 400 and 900 nm, Q is a non-fluorescent quencher, T* is 5-(4-hydroxy-but-1-ynyl)-1H-pyrimidine-2,4-dione, A* is 4, (4,6-Diamino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)-but-3-yn-1-ol, and G* is 6-amino-1H-pyrazolo[3,4-d]pyrimidin-4(5H)-one, wherein one of Ra and Rb comprises a fluorophore and the other comprises a quencher, and wherein the quencher allows quenching of fluorescence when the probe is unhybridized.
17. A method for detecting a methicillin-resistant Staphylococcus aureus (“MRSA”) in a sample containing nucleic acids, comprising:
amplifying the nucleic acids in the sample; and
detecting nucleic acids in the sample comprising amplified genes, wherein the presence of amplified genes consisting of mecA and Idh1 genes in approximately 1:1 ratio indicates the presence of methicillin-resistant Staphylococcus aureus , and wherein a difference in concentration of the amplified genes consisting of amplified mecA and amplified Idh1 genes indicates a mixed infection of Staphylococcus aureus and a coagulase-negative carrier of mecA in the sample, wherein the step of amplifying the nucleic acids in the sample comprises:
(a) contacting the sample with a first primer and a second primer having the formula: 5′-(X)nY-3′, wherein n is 0 or 1, wherein when n is 1 X represents a 5′ portion of the primers that is non-complementary to the Idh1 gene and X is about 3-30 nucleotides in length, wherein Y represents a 3′ portion of the primers that is complementary to the Idh1 gene;
(b) contacting the sample after step (a) with a third primer and a fourth primer having the formula: 5′-(X)nY′-3′, wherein n is 0 or 1, wherein when n is 1 X represents a 5′ portion of the primers that is non-complementary to the mecA gene and X is about 3-30 nucleotides in length, and wherein Y′ represents a 3′ portion of the primers that is complementary to the mecA gene; and
(c) incubating the sample following steps (a) and (b) under conditions sufficient to amplify the Idh1 and mecA genes, wherein the amplified mecA and Idh1 genes are detected by hybridization to a mecA specific probe and a Idh1 specific probe, and wherein the mecA specific fluorescence generating probe comprises SEQ ID NO: 11 5′-Ra-G*AAAGGATCTGTACTGG*G-Rb 5′, wherein Ra is (M) a -Fl or (M) a -Q, Rb is (M) a -Fl or (M) a -Q, M is a minor groove binder, a is 0 or 1, F1 is a fluorophore with emission wavelength between about 400 and 900 nm, Q is a non-fluorescent quencher, and G* is 6-amino-1H-pyrazolo[3,4-d]pyrimidin-4(5H)-one, wherein one of Ra and Rb comprises a fluorophore and the other comprises a quencher, and wherein the quencher allows quenching of fluorescence when the probe is unhybridized.