Toll-like receptors

1. An immunostimulatory non-methylated phosphorothioate (PTO) oligodeoxynucleotide consisting of the general formula selected from the group consisting of:

(i) [tcgN1] n , wherein N1=c or g and n≥6 and ≤100;

(ii) [N1cgt] n , wherein N1=g or c or a or t and n≥6 and ≤100;

(iii) [gacgtt] n , wherein n≥4 and ≤100;

(iv) [gacgatcgtc] n , [SEQ ID NO: 214] wherein n≥3 and ≤100;

(v) [tcgtcgttttcg] n , [SEQ ID NO: 215] wherein n≥3 and ≤100,

(vi) [tcgtcgttgtcgttttgtcgtt] n , [SEQ ID NO: 216] wherein n≥2 and ≤100;

(vii) (t x [ttcgtt]t y ) n , wherein n≥5 and ≤100, x=0-5 and y=0-5;

(viii) [ttcgtN 1 ] n , wherein N 1 =t or c and wherein n≥5 and ≤100;

(ix) [N 1 tcgtc] n , wherein N 1 =t or c and wherein n≥5 and ≤100;

(x) [gN 1 cgtt] n , wherein n≥4 and ≤100 and N 1 =a or t; and

(xi) [acga] n , and wherein n≥6 and ≤100.

2. The oligodeoxynucleotide claim 1 , wherein said oligodeoxynucleotide is coupled to a carrier or hapten.

3. A vector comprising the oligodeoxynucleotide of claim 1 .

4. A method of preventing or combating an infectious disease in a canine, by administering a vaccine to the canine in need thereof, wherein said vaccine comprises an immunological amount of an antigen component, a pharmaceutically acceptable carrier, and an immunostimulatory amount of a composition selected from the group consisting of an immunostimulatory non-methylated phosphorothioate (PTO) oligodeoxynucleotide consisting of the general formula [tcg] n , the oligodeoxynucleotide consisting of the general formula [tcg] n coupled to a carrier or hapten, a vector comprising the oligodeoxynucleotide consisting of the general formula [tcg] n , and a vector comprising the oligodeoxynucleotide consisting of the general formula [tcg] n coupled to a carrier or hapten; and wherein n≥6 and ≤100.