Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.
1. A composition comprising
(a) a chimeric Cas9 protein or a nucleic acid encoding the chimeric Cas9 protein, wherein the chimeric Cas9 protein comprises a Cas9 polypeptide fused to a heterologous polypeptide, wherein the Cas9 polypeptide comprises one or more mutations in a RuvC domain and/or an HNH domain; and
(b) a DNA-targeting RNA comprising:
(i) a targeter-RNA that is capable of hybridizing with a target sequence of a target DNA, and
(ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded duplex,
wherein (i) and (ii) are covalently linked,
wherein the DNA-targeting RNA is capable of forming a complex with the chimeric Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the chimeric Cas9 protein to the target DNA.
2. The composition of claim 1 , comprising a protein-RNA complex comprising the chimeric Cas9 protein and the DNA-targeting RNA.
3. The composition of claim 1 , wherein the heterologous polypeptide comprises a transcriptional activator polypeptide or a transcription repressor polypeptide.
4. The composition of claim 1 , wherein the heterologous polypeptide has DNA-modifying activity.
5. The composition of claim 4 , wherein the DNA modifying activity is methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity, or glycosylase activity.
6. The composition of claim 1 , wherein the heterologous polypeptide comprises one or more of: a 6xHis tag, a hemagglutinin (HA) tag, and a green fluorescent protein.
7. The composition of claim 1 , wherein the heterologous polypeptide is a protein tag.
8. The composition of claim 1 , wherein the heterologous polypeptide has protein-modifying activity.
9. The composition of claim 1 , comprising the nucleic acid encoding the chimeric Cas9 protein.
10. The composition of claim 9 , wherein the nucleic acid encoding the chimeric Cas9 protein is an RNA.
11. The composition of claim 9 , wherein the nucleic acid encoding the chimeric Cas9 protein is a DNA.
12. The composition of claim 9 , wherein the nucleic acid encoding the chimeric Cas9 protein is a plasmid, a cosmid, a minicircle, a phage, or a viral vector.
13. The composition of claim 1 , wherein:
(1) the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUC GGUGCUUUUUUU (SEQ ID NO: 432); or
(2) the activator RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 397).
14. The composition of claim 1 , wherein the DNA-targeting RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.
15. The composition of claim 14 , wherein the DNA-targeting RNA comprises said non-natural internucleoside linkage and/or said modified sugar moiety.
16. The composition of claim 14 , wherein the DNA-targeting RNA comprises said non-natural internucleoside linkage.
17. The composition of claim 1 , wherein the DNA-targeting RNA comprises one or more of: a phosphorothioate, an inverted polarity linkage, an abasic nucleoside linkage, a locked nucleic acid (LNA), a 2′-O-methoxyethyl modified sugar moiety, a 2′-O-methyl modified sugar moiety, a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-fluoro modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, a 2′-dimethylaminoethoxyethoxy modified sugar moiety, a peptide nucleic acid (PNA), a morpholino nucleic acid, and a cyclohexenyl nucleic acid (CeNA).
18. The composition of claim 17 , wherein the DNA-targeting RNA comprises said 2′-O-methyl modified sugar moiety and/or said 2′-fluoro modified sugar moiety.
19. The composition of claim 1 , wherein the DNA-targeting RNA comprises a phosphorothioate internucleoside linkage.
20. A kit comprising
(a) a chimeric Cas9 protein or a nucleic acid encoding the chimeric Cas9 protein, wherein the chimeric Cas9 protein comprises a Cas9 polypeptide fused to a heterologous polypeptide, wherein the Cas9 polypeptide comprises one or more mutations in a RuvC domain and/or an HNH domain; and
(b) a DNA-targeting RNA comprising:
(i) a targeter-RNA that is capable of hybridizing with a target sequence of a target DNA, and
(ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded duplex,
wherein (i) and (ii) are covalently linked,
wherein the DNA-targeting RNA is capable of forming a complex with the chimeric Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the chimeric Cas9 protein to the target DNA; and
wherein (a) and (b) are separated.
21. The kit of claim 20 , wherein the heterologous polypeptide comprises a transcriptional activator polypeptide or a transcription repressor polypeptide.
22. The kit of claim 20 , wherein the heterologous polypeptide has DNA-modifying activity.
23. The kit of claim 22 , wherein the DNA modifying activity is methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity, or glycosylase activity.
24. The kit of claim 20 , wherein the heterologous polypeptide has protein-modifying activity.
25. The kit of claim 20 , comprising the chimeric Cas9 protein.
26. The kit of claim 20 , comprising the nucleic acid encoding the chimeric Cas9 protein.
27. The kit of claim 26 , wherein the nucleic acid encoding the chimeric Cas9 protein is an RNA.
28. The kit of claim 26 , wherein the nucleic acid encoding the chimeric Cas9 protein is a plasmid, a cosmid, a minicircle, a phage, or a viral vector.
29. The kit of claim 20 , wherein the DNA-targeting RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.
30. The kit of claim 29 , wherein the DNA-targeting RNA comprises said non-natural internucleoside linkage and/or said modified sugar moiety.