IP Library Granted Patent US 11,015,199
Granted Patent B2
US 11,015,199 · App. 15/774,569 · Granted May 25, 2021

Cancer therapy

Inventor: Paul Dyson (Swansea, GB)
Assignee: Swansea University
C12N15/1135A61K35/74A61P35/00C12N15/1136C12N15/1137C12N15/88A61K2035/11C12N2310/14C12N2320/32C12N2330/51
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 11,015,199
App. No.
15/774,569
Granted
May 25, 2021
Kind
B2
Abstract

The invention relates to a genetically transformed or transfected bacterial cell chromosome wherein said cell is made to express interfering RNA (siRNA) active against at least one gene encoding a cancer promoting or sustaining protein such as an oncogene, a chemo-resistant gene or a metabolic gene; siRNA cassette encoding at least one siRNA active against said gene; a bacterial cell with said siRNA cassette integrated within the bacterial chromosome; a method of treating cancer, particularly but not exclusively prostate, breast or colorectal cancer, employing the use of said bacterial cell with a chromosomally integrated siRNA cassette; and use of said bacterial cell with a chromosomally integrated siRNA cassette to treat said cancer.

Claims (37)

1. A genetically transformed or transfected Salmonella SL7207 cell able to invade human tissue, wherein a chromosome of the genetically transformed or transfected Salmonella SL7207 cell expresses siRNA active against at least one gene encoding an oncogene, a chemo-resistant gene or a metabolic gene,

wherein said Salmonella SL7207 cell is transformed or transfected such that nucleic acid encoding said siRNA is stably integrated into the Salmonella SL7207 cell chromosome, and

wherein said siRNA is under the control of a pTAC promoter to enable expression of said siRNA within a tumour cell.

2. The genetically transformed or transfected Salmonella SL7207 cell of claim 1 , wherein said oncogene gives rise to a solid tumour.

3. The genetically transformed or transfected Salmonella SL7207 cell of claim 1 , wherein said oncogene is selected from the group consisting of: AR; C-MYC; BCL-2; and HER-2.

4. The genetically transformed or transfected Salmonella SL7207 cell of claim 1 , wherein said chemo-resistant gene is Mdr1.

5. The genetically transformed or transfected Salmonella SL7207 cell of claim 1 , wherein said metabolic gene is poly ADP ribose polymerase (PARP) or pro-angiogenic growth factor genes.

6. The genetically transformed or transfected Salmonella SL7207 cell according to claim 1 , wherein said Salmonella SL7207 cell is modified using lambda red recombination or RecA-mediated recombination.

7. The genetically transformed or transfected Salmonella SL7207 cell according to claim 1 , wherein said Salmonella SL7207 cell is modified at a location within the bacterial chromosome so that the nucleic acid encoding said siRNA is stably inherited at cell division in the absence of any selection.

8. The genetically transformed or transfected Salmonella SL7207 cell according to claim 1 , wherein said siRNA comprises a strand of RNA that shares 50% or at least 75%, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, complementarity to said oncogene, chemo-resistant gene or metabolic gene.

9. The genetically transformed or transfected Salmonella SL7207 cell according to claim 1 , wherein said siRNA is complementary to the part of the oncogene, chemo-resistant gene or metabolic gene that comprises one or more genetic mutations that is/are responsible for the oncogenic nature of the oncogene or the or chemo-resistant nature of the chemo-resistant gene or the effect of the metabolic gene.

10. The genetically transformed or transfected Salmonella SL7207 cell of claim 1 , wherein said Salmonella SL7207 cell is also genetically engineered such that it does not produce functional RNA degrading protein.

11. The genetically transformed or transfected Salmonella SL7207 cell of claim 1 , wherein said siRNA is integrated in the mc gene.

12. The genetically transformed or transfected Salmonella SL7207 cell of claim 1 , wherein said siRNA is selected from the group consisting of:

(SEQ ID NO: 1)

AAGAAGGCCAGTTGTATGGAC;

(SEQ ID NO: 2)

GAGCAAGAAGATGAGGAAG;

(SEQ ID NO: 3)

AACATCGCCCTGTGGATGACT;

(SEQ ID NO: 4)

AACAAAGAAATCTTAGACGAA;

(SEQ ID NO: 5)

CGGCGCATAAGAAGCATAT;

(SEQ ID NO: 6)

GTCCATACAACTGGCCTTCTT;

(SEQ ID NO: 7)

CTTCCTCATCTTCTTGCTC;

(SEQ ID NO: 8)

AGTCATCCACAGGGCGATGTT;

(SEQ ID NO: 9)

TTCGTCTAAGATTTCTTTGTT

and

(SEQ ID NO: 10)

ATATGCTTCTTATGCGCCG.

13. A method of treating cancer in a subject, comprising:

administering an effective amount of the Salmonella SL7207 cell of claim 1 to a subject having or suspected of having cancer thereby arresting growth or reducing size of a tumour and treating the cancer in the subject.

Assignments (1)
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded May 8, 2018
From: DYSON, PAUL
To: SWANSEA UNIVERSITY
Reel/Frame 045747/0971 →
Priority Claims (1)
GB 1519734 · Nov 9, 2015 · national
Continuity (1)
Related Publication 20190112607A1 · Apr 18, 2019