Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.
1. A composition comprising:
a DNA-targeting RNA comprising:
(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA; and
(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase,
wherein the DNA-targeting RNA is capable of forming a complex with a Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the complex to the target DNA.
2. The composition of claim 1 , wherein the targeter-RNA and the activator-RNA are not covalently linked to one another by intervening nucleotides.
3. The composition of claim 1 , wherein the targeter-RNA and the activator-RNA are two separate RNA molecules.
4. The composition of claim 1 , wherein the activator-RNA comprises the non-natural internucleoside linkage and/or the modified sugar moiety.
5. The composition of claim 1 , wherein the activator-RNA comprises one or more of:
(1) the non-natural internucleoside linkage, which comprises a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage,
(2) the modified sugar moiety, which comprises a locked nucleic acid (LNA) sugar moiety, a 2′-substituted sugar moiety, a 2′-O-methoxyethyl modified sugar moiety, a 2′-O-methyl modified sugar moiety, a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-fluoro modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, or a 2′-dimethylaminoethoxyethoxy modified sugar moiety, and
(3) the nucleic acid mimetic, which comprises a peptide nucleic acid (PNA), a morpholino nucleic acid, or a cyclohexenyl nucleic acid (CeNA).
6. The composition of claim 1 , wherein the activator-RNA comprises:
(1) the non-natural internucleoside linkage, which comprises a phosphorothioate, a phosphoramidate, a non-phosphodiester, a heteroatom, a chiral phosphorothioate, a phosphorodithioate, a phosphotriester, an aminoalkylphosphotriester, a 3′-alkylene phosphonates, a 5′-alkylene phosphonate, a chiral phosphonate, a phosphinate, a, a 3′-amino phosphoramidate, an aminoalkylphosphoramidate, a phosphorodiamidate, a thionophosphoramidate, a thionoalkylphosphonate, a thionoalkylphosphotriester, a selenophosphate, or a boranophosphate; and/or
(2) the modified nucleobase, which comprises a 5-methylcytosine; a 5-hydroxymethyl cytosine; a xanthine; a hypoxanthine; a 2-aminoadenine; a 6-methyl derivative of adenine; a 6-methyl derivative of guanine; a 2-propyl derivative of adenine; a 2-propyl derivative of guanine; a 2-thiouracil; a 2-thiothymine; a 2-thiocytosine; a 5-propynyl uracil; a 5-propynyl cytosine; a 6-azo uracil; a 6-azo cytosine; a 6-azo thymine; a pseudouracil; a 4-thiouracil; an 8-haloadenin; an 8-aminoadenin; an 8-thioladenin; an 8-thioalkyladenin; an 8-hydroxyladenin; an 8-haloguanin; an 8-aminoguanin; an 8-thiolguanin; an 8-thioalkylguanin; an 8-hydroxylguanin; a 5-halouracil; a 5-bromouracil; a 5-trifluoromethyluracil; a 5-halocytosine; a 5-bromocytosine; a 5-trifluoromethylcytosine; a 5-substituted uracil; a 5-substituted cytosine; a 7-methylguanine; a 7-methyladenine; a 2-F-adenine; a 2-amino-adenine; an 8-azaguanine; an 8-azaadenine; a 7-deazaguanine; a 7-deazaadenine; a 3-deazaguanine; a 3-deazaadenine; a tricyclic pyrimidine; a phenoxazine cytidine; a phenothiazine cytidine; a substituted phenoxazine cytidine; a carbazole cytidine; a pyridoindole cytidine; a 7-deazaguanosine; a 2-aminopyridine; a 2-pyridone; a 5-substituted pyrimidine; a 6-azapyrimidine; an N-2, N-6 or O-6 substituted purine; a 2-aminopropyladenine; a 5-propynyluracil; or a 5-propynylcytosine.
7. The composition of claim 1 , wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 15-25 nucleotides (nt) long.
8. The composition of claim 1 , wherein the targeter-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.
9. The composition of claim 1 , wherein
(1) the targeter-RNA comprises, and/or
(2) the activator-RNA, in addition to said to said one or more of: the non-natural internucleoside linkage, the nucleic acid mimetic, the modified sugar moiety, and the modified nucleobase, further comprises,
a heterologous moiety.
10. The composition of claim 1 , wherein
(1) the targeter-RNA comprises, and/or
(2) the activator-RNA, in addition to said to said one or more of: the non-natural internucleoside linkage, the nucleic acid mimetic, the modified sugar moiety, and the modified nucleobase, further comprises,
one or more of the following heterologous moieties: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioester; a thiocholesterol; a lipid; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a coumarin; and a dye.
11. The composition of claim 1 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441) or the 67 nucleotide tracrRNA sequence
(SEQ ID NO: 432)
UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACC
GAGUCGGUGCUUUUUUU.
12. A composition comprising:
(a) a Cas9 protein, or a nucleic acid encoding the Cas9 protein; and
(b) a DNA-targeting RNA comprising:
(i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA; and
(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase,
wherein the DNA-targeting RNA is capable of forming a complex with the Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the complex to the target DNA.
13. The composition of claim 12 , comprising a protein-RNA complex that comprises the Cas9 protein and the DNA-targeting RNA.
14. The composition of claim 13 , wherein the Cas9 protein comprises a mutation in a RuvC and/or an HNH domain.
15. The composition of claim 12 , wherein the Cas9 protein comprises a mutation in a RuvC and/or an HNH domain.
16. The composition of claim 15 , wherein the Cas9 protein is an S. pyogenes Cas9.
17. The composition of claim 12 , wherein the Cas9 protein is fused to a heterologous polypeptide.
18. The composition of claim 12 , wherein the Cas9 protein is fused to a heterologous polypeptide that comprises one or more of: a protein tag, an endosomolytic domain, an influenza HA domain, an IF2 domain, a GST domain, a GRPE domain, a 6×His tag, a hemagglutinin (HA) tag, and green fluorescent protein.
19. The composition of claim 12 , wherein the nucleic acid encoding the Cas9 protein comprises a nucleotide sequence modification that replaces one or more codons of a wild-type Cas9-encoding nucleotide sequence with one or more different codons encoding the same amino acid.
20. The composition of claim 12 , wherein the nucleic acid encoding the Cas9 protein is a cosmid, a minicircle, a phage, or a viral vector.
21. The composition of claim 12 , wherein the Cas9 protein is an S. pyogenes Cas9.
22. The composition of claim 12 , wherein the targeter-RNA and the activator-RNA are not covalently linked to one another by intervening nucleotides.
23. The composition of claim 12 , wherein the targeter-RNA and the activator-RNA are two separate RNA molecules.
24. The composition of claim 12 , wherein the activator-RNA comprises the non-natural internucleoside linkage and/or the modified sugar moiety.
25. The composition of claim 12 , wherein the activator-RNA comprises one or more of:
(1) the non-natural internucleoside linkage, which comprises a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage,
(2) the modified sugar moiety, which comprises a locked nucleic acid (LNA) sugar moiety, a 2′-substituted sugar moiety, a 2′-O-methoxyethyl modified sugar moiety, a 2′-O-methyl modified sugar moiety, a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-fluoro modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, or a 2′-dimethylaminoethoxyethoxy modified sugar moiety, and
(3) the nucleic acid mimetic, which comprises a peptide nucleic acid (PNA), a morpholino nucleic acid, or a cyclohexenyl nucleic acid (CeNA).
26. The composition of claim 12 , wherein the activator-RNA comprises:
(1) the non-natural internucleoside linkage, which comprises a phosphorothioate, a phosphoramidate, a non-phosphodiester, a heteroatom, a chiral phosphorothioate, a phosphorodithioate, a phosphotriester, an aminoalkylphosphotriester, a 3′-alkylene phosphonates, a 5′-alkylene phosphonate, a chiral phosphonate, a phosphinate, a, a 3′-amino phosphoramidate, an aminoalkylphosphoramidate, a phosphorodiamidate, a thionophosphoramidate, a thionoalkylphosphonate, a thionoalkylphosphotriester, a selenophosphate, or a boranophosphate; and/or
(2) the modified nucleobase, which comprises a 5-methylcytosine; a 5-hydroxymethyl cytosine; a xanthine; a hypoxanthine; a 2-aminoadenine; a 6-methyl derivative of adenine; a 6-methyl derivative of guanine; a 2-propyl derivative of adenine; a 2-propyl derivative of guanine; a 2-thiouracil; a 2-thiothymine; a 2-thiocytosine; a 5-propynyl uracil; a 5-propynyl cytosine; a 6-azo uracil; a 6-azo cytosine; a 6-azo thymine; a pseudouracil; a 4-thiouracil; an 8-haloadenin; an 8-aminoadenin; an 8-thioladenin; an 8-thioalkyladenin; an 8-hydroxyladenin; an 8-haloguanin; an 8-aminoguanin; an 8-thiolguanin; an 8-thioalkylguanin; an 8-hydroxylguanin; a 5-halouracil; a 5-bromouracil; a 5-trifluoromethyluracil; a 5-halocytosine; a 5-bromocytosine; a 5-trifluoromethylcytosine; a 5-substituted uracil; a 5-substituted cytosine; a 7-methylguanine; a 7-methyladenine; a 2-F-adenine; a 2-amino-adenine; an 8-azaguanine; an 8-azaadenine; a 7-deazaguanine; a 7-deazaadenine; a 3-deazaguanine; a 3-deazaadenine; a tricyclic pyrimidine; a phenoxazine cytidine; a phenothiazine cytidine; a substituted phenoxazine cytidine; a carbazole cytidine; a pyridoindole cytidine; a 7-deazaguanosine; a 2-aminopyridine; a 2-pyridone; a 5-substituted pyrimidine; a 6-azapyrimidine; an N-2, N-6 or O-6 substituted purine; a 2-aminopropyladenine; a 5-propynyluracil; or a 5-propynylcytosine.
27. The composition of claim 12 , wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 15-25 nucleotides (nt) long.
28. The composition of claim 12 , wherein
(1) the targeter-RNA comprises, and/or
(2) the activator-RNA, in addition to said to said one or more of: the non-natural internucleoside linkage, the nucleic acid mimetic, the modified sugar moiety, and the modified nucleobase, further comprises,
a heterologous moiety.
29. The composition of claim 12 , wherein
(1) the targeter-RNA comprises, and/or
(2) the activator-RNA, in addition to said to said one or more of: the non-natural internucleoside linkage, the nucleic acid mimetic, the modified sugar moiety, and the modified nucleobase, further comprises,
one or more of the following heterologous moieties: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioester; a thiocholesterol; a lipid; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a coumarin; and a dye.
30. The composition of claim 12 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441) or the 67 nucleotide tracrRNA sequence
(SEQ ID NO: 432)
UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACC
GAGUCGGUGCUUUUUUU.