RNA-guided human genome engineering
A method of altering a eukaryotic cell is provided including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
1. A method of altering a eukaryotic cell comprising
providing to a eukaryotic cell a first guide RNA comprising a scaffold sequence and a spacer sequence complementary to a first target nucleic acid sequence and a second guide RNA comprising a scaffold sequence and a spacer sequence complementary to a second target nucleic acid sequence, wherein each guide RNA is a crRNA-tracrRNA fusion of between 100 to about 250 nucleotides,
providing to the cell a Cas enzyme of a Type II CRISPR system,
wherein the first guide RNA binds to the first target nucleic acid sequence, the second guide RNA binds to the second target nucleic acid sequence and the Cas enzyme cleaves the first and second target nucleic acid sequences in a site specific manner to remove an intervening fragment.
2. The method of claim 1
wherein the first and second guide RNAs are provided to the cell by introducing to the cell a nucleic acid encoding the first guide RNA and a nucleic acid encoding the second guide RNA,
wherein the Cas enzyme is provided to the cell by introducing to the cell a nucleic acid encoding the Cas enzyme, and
wherein the cell expresses the first and second guide RNAs and the Cas enzyme.
3. The method of claim 1 wherein the cell is a yeast cell, a plant cell or a mammalian cell.
4. The method of claim 1 wherein the cell is a human cell.
5. The method of claim 1 wherein the Cas enzyme is encoded by a human codon optimized nucleic acid.
6. The method of claim 1 wherein the Cas enzyme includes a nuclear localization signal.
7. The method of claim 1 wherein the scaffold sequence of the first guide RNA comprises
(SEQ ID NO: 46)
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC
UUGAAAAAGUGGCACCGAGUCGGUGC.
8. The method of claim 1 wherein the scaffold sequence of the first guide RNA comprises
(SEQ ID NO: 45)
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC
UUGAAAAAGUGGCACCGAGUCGGUGCUUUU.
9. The method of claim 1 wherein the scaffold sequence of the second guide RNA comprises
(SEQ ID NO: 46)
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC
UUGAAAAAGUGGCACCGAGUCGGUGC.
10. The method of claim 1 wherein the scaffold sequence of the second guide RNA comprises
(SEQ ID NO: 45)
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC
UUGAAAAAGUGGCACCGAGUCGGUGCUUUU.
11. The method of claim 1 wherein the cell is a stem cell.
12. The method of claim 1 wherein the cell is an induced pluripotent stem cell.
13. A method of altering a eukaryotic cell comprising
providing to a eukaryotic cell a first guide RNA comprising a scaffold sequence and a spacer sequence complementary to a first target nucleic acid sequence and a second guide RNA comprising a scaffold sequence and a spacer sequence complementary to a second target nucleic acid sequence, wherein each guide RNA is a crRNA-tracrRNA fusion of between 100 to about 250 nucleotides,
providing to the cell a Cas enzyme of a Type II CRISPR system,
wherein the first guide RNA binds to the first target nucleic acid sequence, the second guide RNA binds to the second target nucleic acid sequence and the Cas enzyme cleaves the first and second target nucleic acid sequences in a site specific manner to remove an intervening fragment,
wherein the scaffold sequence of the first guide RNA and the scaffold sequence of the second guide RNA each comprise
(SEQ ID NO: 46)
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC
UUGAAAAAGUGGCACCGAGUCGGUGC.
14. The method of claim 13
wherein the first and second guide RNAs are provided to the cell by introducing to the cell a nucleic acid encoding the first guide RNA and a nucleic acid encoding the second guide RNA,
wherein the Cas enzyme is provided to the cell by introducing to the cell a nucleic acid encoding the Cas enzyme, and
wherein the cell expresses the first and second guide RNAs and the Cas enzyme.
15. The method of claim 13 wherein the cell is a yeast cell, a plant cell or a mammalian cell.
16. The method of claim 13 wherein the cell is a human cell.
17. The method of claim 13 wherein the cell is a stem cell.
18. The method of claim 13 wherein the cell is an induced pluripotent stem cell.
19. The method of claim 13 wherein the Cas enzyme is encoded by a human codon optimized nucleic acid.
20. The method of claim 13 wherein the Cas enzyme includes a nuclear localization signal.
21. The method of claim 13 wherein the Cas enzyme is a Cas9 enzyme.
22. A method of altering a eukaryotic cell comprising
providing to a eukaryotic cell a first guide RNA comprising a scaffold sequence and a spacer sequence complementary to a first target nucleic acid sequence and a second guide RNA comprising a scaffold sequence and a spacer sequence complementary to a second target nucleic acid sequence, wherein each guide RNA is a crRNA-tracrRNA fusion of between 100 to about 250 nucleotides,
providing to the cell a Cas 9 enzyme,
wherein the first guide RNA binds to the first target nucleic acid sequence, the second guide RNA binds to the second target nucleic acid sequence and the Cas 9 enzyme cleaves the first and second target nucleic acid sequences in a site specific manner to remove an intervening fragment.
23. The method of claim 22
wherein the first and second guide RNAs are provided to the cell by introducing to the cell a nucleic acid encoding the first guide RNA and a nucleic acid encoding the second guide RNA,
wherein the Cas 9 enzyme is provided to the cell by introducing to the cell a nucleic acid encoding the Cas 9 enzyme, and
wherein the cell expresses the first and second guide RNAs and the Cas 9 enzyme.
24. The method of claim 22 wherein the cell is a yeast cell, a plant cell or a mammalian cell.
25. The method of claim 22 wherein the cell is a human cell.
26. The method of claim 22 wherein the Cas 9 enzyme is encoded by a human codon optimized nucleic acid.
27. The method of claim 22 wherein the Cas 9 enzyme includes a nuclear localization signal.
28. The method of claim 22 wherein the scaffold sequence of the first guide RNA comprises
(SEQ ID NO: 46)
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC
UUGAAAAAGUGGCACCGAGUCGGUGC.
29. The method of claim 22 wherein the scaffold sequence of the first guide RNA comprises
(SEQ ID NO: 45)
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC
UUGAAAAAGUGGCACCGAGUCGGUGCUUUU.
30. The method of claim 22 wherein the scaffold sequence of the second guide RNA comprises
(SEQ ID NO: 46)
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC
UUGAAAAAGUGGCACCGAGUCGGUGC.
31. The method of claim 22 wherein the scaffold sequence of the second guide RNA comprises
(SEQ ID NO: 45)
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC
UUGAAAAAGUGGCACCGAGUCGGUGCUUUU.
32. The method of claim 22 wherein the cell is a stem cell.
33. The method of claim 22 wherein the cell is an induced pluripotent stem cell.