Muscle targeting complexes and uses thereof for treating dystrophinopathies
Aspects of the disclosure relate to complexes comprising a muscle-targeting agent covalently linked to a molecular payload. In some embodiments, the muscle-targeting agent specifically binds to an internalizing cell surface receptor on muscle cells. In some embodiments, the molecular payload promotes the expression or activity of a functional dystrophin protein. In some embodiments, the molecular payload is an oligonucleotide, such as an antisense oligonucleotide, e.g., an oligonucleotide that causes exon skipping in a mRNA expressed from a mutant DMD allele.
1. A complex comprising an anti-transferrin receptor antibody covalently linked to an exon-skipping oligonucleotide,
wherein the anti-transferrin receptor antibody comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region and the light chain variable region comprise human or humanized framework regions; wherein the anti-transferrin receptor antibody binds in the range of C89 to F760 of human transferrin receptor protein 1 (TfR1) having an amino acid sequence as set forth in SEQ ID NO: 1;
wherein the oligonucleotide of the complex is 30 nucleotides in length and comprises a region of complementarity of 25, 26, 27, 28, 29, or 30 nucleotides in length, wherein the region of complementarity is complementary to the annealing site of an oligonucleotide consisting of the sequence of SEQ ID NO: 195, wherein the oligonucleotide of the complex is a phosphorodiamidate morpholino oligomer (PMO); and
wherein the oligonucleotide of the complex is covalently linked at the 5′ end to a lysine residue of the anti-transferrin receptor antibody via a cleavable linker comprising a valine-citrulline sequence.
2. The complex of claim 1 , wherein the anti-transferrin receptor antibody is in the form of a Fab fragment.
3. The complex of claim 2 , wherein the region of complementarity is 30 nucleotides in length.
4. The complex of claim 3 , wherein the oligonucleotide of the complex comprises 28, 29, or 30 contiguous nucleotides of the sequence of CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 296).
5. The complex of claim 4 , wherein the cleavable linker comprises a triazole covalently linked to the valine-citrulline sequence and further covalently linked to a lysine residue of the anti-transferrin receptor antibody,
wherein the triazole is obtained by a cycloaddition reaction between an azide and an alkyne to form the triazole, and
wherein prior to the cycloaddition reaction, the azide is covalently linked to the valine-citrulline sequence of the cleavable linker that is covalently linked to the 5′ end of the oligonucleotide of the complex, and the alkyne is provided in a bicyclononyne moiety.
6. The complex of claim 5 , wherein the anti-transferrin receptor antibody is not glycosylated.
7. The complex of claim 1 , wherein the nucleobases of the region of complementarity are selected from adenosine, thymidine, guanosine, and cytosine.
8. A composition comprising the complex of claim 1 and a pharmaceutically acceptable carrier, wherein the composition is formulated for intravenous administration.
9. A complex comprising an anti-transferrin receptor antibody covalently linked to an exon-skipping oligonucleotide,
wherein the anti-transferrin receptor antibody comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region and the light chain variable region comprise human or humanized framework regions; wherein the anti-transferrin receptor antibody binds in the range of C89 to F760 of human transferrin receptor protein 1 (TfR1) having an amino acid sequence as set forth in SEQ ID NO: 1;
wherein the oligonucleotide is 30 nucleotides in length, wherein the oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO) comprising the sequence of CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 296); and
wherein the oligonucleotide is covalently linked at the 5′ end to a lysine residue of the anti-transferrin receptor antibody via a cleavable linker comprising a valine-citrulline sequence.
10. The complex of claim 9 , wherein the anti-transferrin receptor antibody is in the form of a Fab fragment.
11. The complex of claim 10 , wherein the cleavable linker comprises a triazole covalently linked to the valine-citrulline sequence and further covalently linked to a lysine residue of the anti-transferrin receptor antibody,
wherein the triazole is obtained by a cycloaddition reaction between an azide and an alkyne to form the triazole, and
wherein prior to the cycloaddition reaction, the azide is covalently linked to the valine-citrulline sequence of the cleavable linker that is covalently linked to the 5′ end of the oligonucleotide and the alkyne is provided in a bicyclononyne moiety.
12. The complex of claim 11 , wherein the anti-transferrin receptor antibody is not glycosylated.
13. A composition comprising the complex of claim 9 and a pharmaceutically acceptable carrier, wherein the composition is formulated for intravenous administration.
14. A method of inducing skipping of exon 51 of a DMD pre-mRNA in a muscle cell of a subject, the method comprising administering to the subject the complex of claim 1 .
15. A method of treating Duchenne muscular dystrophy in a subject in need thereof, the method comprising administering to the subject a complex comprising an anti-transferrin receptor antibody covalently linked to an exon-skipping oligonucleotide,
wherein the anti-transferrin receptor antibody comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region and the light chain variable region comprise human or humanized framework regions; wherein the anti-transferrin receptor antibody binds in the range of C89 to F760 of human transferrin receptor protein 1 (TfR1) having an amino acid sequence as set forth in SEQ ID NO: 1;
wherein the oligonucleotide of the complex is 30 nucleotides in length and comprises a region of complementarity of 25, 26, 27, 28, 29, or 30 nucleotides in length, wherein the region of complementarity is complementary to the annealing site of an oligonucleotide consisting of the sequence of SEQ ID NO: 195, wherein the oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO); and
wherein the oligonucleotide of the complex is covalently linked at the 5′ end to a lysine residue of the anti-transferrin receptor antibody via a cleavable linker comprising a valine-citrulline sequence.
16. The method of claim 15 , wherein the oligonucleotide of the complex comprises the sequence of CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 296), and wherein the anti-transferrin receptor antibody is in the form of a Fab fragment.
17. The method of claim 16 , wherein the cleavable linker comprises a triazole covalently linked to the valine-citrulline sequence and further covalently linked to a lysine residue of the anti-transferrin receptor antibody,
wherein the triazole is obtained by a cycloaddition reaction between an azide and an alkyne to form the triazole, and
wherein prior to the cycloaddition reaction, the azide is covalently linked to the valine-citrulline sequence of the cleavable linker that is covalently linked to the 5′ end of the oligonucleotide of the complex, and the alkyne is provided in a bicyclononyne moiety.
18. The method of claim 15 , wherein the oligonucleotide of the complex promotes the expression or activity of a functional dystrophin protein in a muscle cell of the subject.
19. The method of claim 18 , wherein the muscle cell is a skeletal muscle cell or a cardiac muscle cell.
20. The method of claim 15 , wherein the nucleobases of the region of complementarity are selected from adenosine, thymidine, guanosine, and cytosine.
21. The method of claim 15 , wherein the subject is human.
22. The method of claim 15 , wherein the complex is administered to the subject intravenously.
23. A method of inducing skipping of exon 51 of a DMD pre-mRNA in a muscle cell of a subject, the method comprising administering to the subject the complex of claim 9 .
24. A method of treating Duchenne muscular dystrophy in a subject in need thereof, the method comprising administering to the subject a complex comprising an anti-transferrin receptor antibody covalently linked to an exon-skipping oligonucleotide,
wherein the anti-transferrin receptor antibody comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region and the light chain variable region comprise human or humanized framework regions; wherein the anti-transferrin receptor antibody binds in the range of C89 to F760 of human transferrin receptor protein 1 (TfR1) having an amino acid sequence as set forth in SEQ ID NO: 1;
wherein the oligonucleotide is 30 nucleotides in length, wherein the oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO) comprising the sequence of CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 296); and
wherein the oligonucleotide is covalently linked at the 5′ end to a lysine residue of the anti-transferrin receptor antibody via a cleavable linker comprising a valine-citrulline sequence.
25. The method of claim 24 , wherein the cleavable linker comprises a triazole covalently linked to the valine-citrulline sequence and further covalently linked to a lysine residue of the anti-transferrin receptor antibody,
wherein the triazole is obtained by a cycloaddition reaction between an azide and an alkyne to form the triazole, and
wherein prior to the cycloaddition reaction, the azide is covalently linked to the valine-citrulline sequence of the cleavable linker that is covalently linked to the 5′ end of the oligonucleotide and the alkyne is provided in a bicyclononyne moiety.
26. The method of claim 25 , wherein the anti-transferrin receptor antibody is not glycosylated.
27. The method of claim 24 , wherein the oligonucleotide promotes the expression or activity of a functional dystrophin protein in a muscle cell of the subject.
28. The method of claim 27 , wherein the muscle cell is a skeletal muscle cell or a cardiac muscle cell.
29. The method of claim 24 , wherein the subject is human.
30. The method of claim 24 , wherein the complex is administered to the subject intravenously.