IP Library Granted Patent US 7,049,302
Granted Patent B1
US 7,049,302 · App. 09/369,941 · Granted May 23, 2006

Compositions of CPG and saponin adjuvants and uses thereof

Assignee: Antigenics Inc.
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 7,049,302
App. No.
09/369,941
Granted
May 23, 2006
Kind
B1
Abstract

Vaccine compositions of immunostimulatory oligonucleotides and saponin adjuvants and antigens and the use thereof for stimulating immunity, enhancing cell-mediated immunity, and enhancing antibody production are disclosed. Also described are immune adjuvant compositions comprising immunostimulatory oligonucleotides and saponin adjuvants, as well as methods for increasing an immune response using the same.

Claims (90)

1. An immune adjuvant composition comprising

(a) a saponin possessing immune adjuvant activity, wherein the saponin is derived from Quillaja saponaria ; and

(b) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide,

wherein the immunostimulatory oligonucleotide is not a part of a DNA vaccine vector, and

wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.

2. The immune adjuvant composition as claimed in claim 1 , wherein the saponin comprises a substantially pure saponin.

3. The immune adjuvant composition as claimed in claim 2 , wherein the substantially pure saponin is QS-7, QS-17, QS-18, or QS-21.

4. The immune adjuvant composition as claimed in claim 3 , wherein the substantially pure saponin is QS-21.

5. The immune adjuvant composition as claimed in claim 1 or 4 , wherein the immunostimulatory oligonucleotide comprises more than one unmethylated CpG dinucleotide.

6. The immune adjuvant composition as claimed in claim 1 or 4 , wherein the immunostimulatory oligonucleotide comprises at least one chemical group selected from the group consisting of phosphorothioate, alkylphosphonate, phophorodithioate, alkylphosphorothioate, phosphoramidate, 2-O-methyl, carbamate, acetamidate, carboxymethyl ester, carbonate, and phosphate triester.

7. The immune adjuvant composition as claimed in claim 1 or 4 , wherein the immunostimulatory oligonucleotide comprises at least one phosphorothioate modified nucleotide.

8. The immune adjuvant composition as claimed in claim 1 , wherein the immunostimulatory oligonucleotide comprises a CpG motif having the formula 5′X 1 CGX 2 3′, wherein X 1 is adenine, guanine, or thymine, and X 2 is cytosine, thymine, or adenine.

9. The immune adjuvant composition as claimed in claim 1 or 4 , wherein the immunostimulatory oligonucleotide comprises TCTCCCAGCGTGCGCCAT (SEQ ID NO:1).

10. An immune adjuvant composition comprising

(a) a saponin possessing immune adjuvant activity, wherein the saponin is derived from Quillaja saponaria ; and

(b) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide,

wherein the saponin is substantially pure, and the saponin is QS-7, QS-17 or QS-18, and

wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.

11. A method for inducing an immune response in an individual to an antigen comprising (1) administering an amount of the immune adjuvant composition as claimed in claim 10 to the individual; and (2) administering a nucleic acid molecule comprising a nucleotide sequence encoding the antigen to the individual, wherein (1) and (2) induce an immune response in the individual to the antigen.

12. An immune adjuvant composition comprising

(a) a saponin possessing immune adjuvant activity, wherein the saponin is derived from Quillaja saponaria ; and

(b) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide,

wherein the immunostimulatory oligonucleotide comprises at least one chemical group selected from the group consisting of phosphorothioate, alkylphosphonate, phophorodithioate, alkylphosphorothioate, phosphoramidate, 2-O-methyl, carbamate, acetamidate, carboxymethyl ester, carbonate, and phosphate triester, and

wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.

13. The immune adjuvant composition as claimed in claim 12 , wherein the immunostimulatory oligonucleotide comprises at least one phosphorothioate modified nucleotide.

14. A method for inducing an immune response in an individual to an antigen comprising (1) administering an amount of the immune adjuvant composition as claimed in claim 12 to the individual; and (2) administering a nucleic acid molecule comprising a nucleotide sequence encoding the antigen to the individual, wherein (1) and (2) induce an immune response in the individual to the antigen.

15. A method for inducing an immune response in an individual to an antigen comprising (1) administering an amount of the immune adjuvant composition as claimed in claim 13 to the individual; and (2) administering a nucleic acid molecule comprising a nucleotide sequence encoding the antigen to the individual, wherein (1) and (2) induce an immune response in the individual to the antigen.

16. An immune adjuvant composition comprising

(a) a saponin possessing immune adjuvant activity, wherein the saponin is derived from Quillaja saponaria ; and

(b) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide,

wherein the immunostimulatory oligonucleotide comprises TCTCCCAGCGTFCGCCAT (SEQ ID NO:1), and,

wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.

17. A method for inducing an immune response in an individual to an antigen comprising (1) administering an amount of the immune adjuvant composition as claimed in claim 16 to the individual; and (2) administering a nucleic acid molecule comprising a nucleotide sequence encoding the antigen to the individual, wherein (1) and (2) induce an immune response in the individual to the antigen.

18. An immune adjuvant composition comprising

(a) a saponin possessing immune adjuvant activity, wherein the saponin is derived from Quillaja saponaria ; and

(b) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide,

wherein the immunostimulatory oligonucleotide comprises TCCATGACGTTCCTGACGTT (SEQ ID NO:2), and

wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.

19. A method for inducing an immune response in an individual to an antigen comprising (1) administering an amount of the immune adjuvant composition as claimed in claim 18 to the individual; and (2) administering a nucleic acid molecule comprising a nucleotide sequence encoding the antigen to the individual, wherein (1) and (2) induce an immune response in the individual to the antigen.

20. An immune adjuvant composition comprising

(a) a saponin possessing immune adjuvant activity, wherein the saponin is derived from Quillaja saponaria ; and

(b) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide, wherein the immunostimulatory oligonucleotide is 4–40 bases in length, and

wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.

21. A method for inducing an immune response in an individual to an antigen comprising (1) administering an amount of the immune adjuvant composition as claimed in claim 20 to the individual; and (2) administering a nucleic acid molecule comprising a nucleotide sequence encoding the antigen to the individual, wherein (1) and (2) induce an immune response in the individual to the antigen.

22. An immune adjuvant composition comprising

(a) a saponin possessing immune adjuvant activity, wherein the saponin (i) is derived from Quillaja saponaria and (ii) is a chemically modified saponin; and

(b) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide,

wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.

23. A method for inducing an immune response in an individual to an antigen comprising (1) administering an amount of the immune adjuvant composition as claimed in claim 22 to the individual; and (2) administering a nucleic acid molecule comprising a nucleotide sequence encoding the antigen to the individual, wherein (1) and (2) induce an immune response in the individual to the antigen.

24. The composition of claim 1 , wherein the saponin is a chemically modified saponin.

25. The immune adjuvant composition as claimed in claim 1 or 4 , wherein the immunostimulatory oligonucleotide comprises TCCATGACGTTCCTGACGTT (SEQ ID NO:2).

26. A method for inducing an immune response in an individual to an antigen comprising (1) administering an amount of the immune adjuvant composition as claimed in claim 1 to the individual; and (2) administering a nucleic acid molecule comprising a nucleotide sequence encoding the antigen to the individual, wherein (1) and (2) induce an immune response in the individual to the antigen.

27. The method as claimed in any of claims 14 , 15 , 17 , 19 , 21 , 23 , or 26 , wherein the saponin comprises is a substantially pure saponin.

28. The method as claimed in claim 27 , wherein the substantially pure saponin is QS-7, QS-17, QS-18, or QS-21.

29. The method as claimed in claim 28 , wherein the substantially pure saponin is QS-21.

30. The method as claimed in any of claims 11 , 14 , 15 , 17 , 19 , 21 , 23 , or 26 , wherein the immunostimulatory oligonucleotide comprises more than one unmethylated CpG dinucleotide.

31. The method as claimed in any of claims 11 , 17 , 19 , 21 , 23 , or 26 , wherein the immunostimulatory oligonucleotide comprises at least one chemical group selected from the group consisting of phosphorothioate, alkylphosphonate, phophorodithioate, alkylphosphorothioate, phosphoramidate, 2-O-methyl, carbamate, acetamidate, carboxymethyl ester, carbonate, and phosphate triester.

32. The method as claimed in any of claims 11 , 17 , 19 , 21 , 23 , or 26 , wherein the immunostimulatory oligonucleotide comprises at least one phosphorothioate modified nucleotide.

33. The method as claimed in any of claims 11 , 14 , 15 , 17 , 19 , 21 , 23 , or 26 , wherein the immunostimulatory oligonucleotide comprises a CpG motif having the formula 5′X 1 CGX 2 3′, wherein X 1 is adenine, guanine, or thymine, and X 2 is cytosine, thymine, or adenine.

34. The method as claimed in any of claims 11 , 14 , 15 , 21 , 23 , or 26 , wherein the immunostimulatory oligonucleotide comprises TCTCCCAGCGTGCGCCAT (SEQ ID NO:1) or TCCATGACGTTCCTGACGTT (SEQ ID NO:2).

35. The method as claimed in any of claims 11 , 14 , 15 , 21 , 19 , 21 , 23 , or 26 , wherein the individual is an animal.

36. The method as claimed in claim 35 , wherein the animal is a mammal.

37. The method as claimed in any of claims 11 , 14 , 15 , 21 , 19 , 21 , 23 , or 26 , wherein the individual is a human.

38. A vaccine composition comprising

(a) a saponin possessing immune adjuvant activity, wherein the saponin is derived from Quillaja saponaria;

(b) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide; and

(c) a nucleic acid molecule comprising a nucleotide sequence encoding an antigen, wherein the nucleotide sequence is operatively linked to a promoter,

wherein the immunostimulatory oligonucleotide is not a part of the nucleic acid molecule comprising the nucleotide sequence encoding the antigen.

39. The vaccine composition as claimed in claim 38 , wherein the saponin is a substantially pure saponin.

40. The vaccine composition as claimed in claim 39 , wherein the substantially pure saponin is QS-7, QS-17, QS-18, or QS-21.

41. The vaccine composition as claimed in claim 40 , wherein the substantially pure saponin is QS-21.

42. The vaccine composition as claimed in claim 38 , wherein the immunostimulatory oligonucleotide comprises more than one unmethylated CpG dinucleotide.

43. The vaccine composition as claimed in claim 38 , wherein the immunostimulatory oligonucleotide comprises at least one chemical group selected from the group consisting of phosphorothioate, alkylphosphonate, phophorodithioate, alkylphosphorothioate, phosphoramidate, 2-O-methyl, carbamate, acetamidate, carboxymethyl ester, carbonate, and phosphate triester.

44. The vaccine composition as claimed in claim 38 , wherein the immunostimulatory oligonucleotide comprises at least one phosphorothioate modified nucleotide.

45. The vaccine composition as claimed in claim 38 , wherein the immunostimulatory oligonucleotide comprises a CpG motif having the formula 5′X 1 CGX 2 3′, wherein X 1 is adenine, guanine, or thymine, and X 2 is cytosine, thymine, or adenine.

46. The vaccine composition as claimed in claim 38 or 41 , wherein the immunostimulatory oligonucleotide comprises TCTCCCAGCGTGCGCCAT (SEQ ID NO:1) or TCCATGACGTTCCTGACGTT (SEQ ID NO:2).

47. The method of any of claims 11 , 17 , 19 , 23 , or 26 , wherein the nucleic acid molecule encoding the antigen is administered to the individual concurrently with the immune adjuvant composition.

48. The method of any of claims 14 , 15 , or 21 , wherein the nucleic acid molecule encoding the antigen is administered to the individual concurrently with the immune adjuvant composition.

49. The method as claimed in any of claims 14 , 15 , 21 , 23 , and 26 , wherein the saponin is substantially pure, wherein the saponin is QS-21, and wherein the immunostimulatory oligonucleotide comprises TCTCCCAGCGTGCGCCAT (SEQ ID NO:1or TCCATGACGTTCCTGACGTT (SEQ ID NO:2).

50. The immune adjuvant composition as claimed in claim 12 or 20 , wherein the saponin is chemically modified.

51. The immune adjuvant composition as claimed in claim 12 , 20 or 22 , wherein the immunostimulatory oligonucleotide comprises TCTCCCAGCGTGCGCCAT (SEQ ID NO:1) or TCCATGACGTTCCTGACGTT (SEQ ID NO:2).

52. The immune adjuvant composition as claimed in claim 12 or 22 , wherein the saponin is substantially pure.

53. The immune adjuvant composition as claimed in claim 52 , wherein the saponin is QS-21.

54. The immune adjuvant composition as claimed in claim 53 , wherein the immunostimulatory oligonucleotide comprises TCTCCCAGCGTGCGCCAT (SEQ ID NO:1) or TCCATGACGTTCCTGACGTT (SEQ ID NO:2).

55. The immune adjuvant composition as claimed in claim 20 , wherein the saponin is substantially pure.

56. The immune adjuvant composition as claimed in claim 55 , wherein the saponin is QS-21.

57. The immune adjuvant composition as claimed in claim 20 or 56 , wherein the immunostimulatory oligonucleotide comprises at least one chemical group selected from the group consisting of phosphorothioate, alkylphosphonate, phophorodithioate, alkylphosphorothioate, phosphoramidate, 2-O-methyl, carbamate, acetamidate, carboxymethyl ester, carbonate, and phosphate triester.

58. The immune adjuvant composition as claimed in claim 56 , wherein the immunostimulatory oligonucleotide comprises TCTCCCAGCGTGCGCCAT (SEQ ID NO:1) or TCCATGACGTTCCTGACGTT (SEQ ID NO:2).

59. The immune adjuvant composition as claimed in claim 16 or 18 , wherein the saponin is substantially pure.

60. The immune adjuvant composition as claimed in claim 59 , wherein the saponin is QS-21.

Assignments (3)
CHANGE OF NAME Recorded Dec 2, 2015
From: ANTIGENICS INC
To: ANTIGENICS LLC
Reel/Frame 037197/0054 →
MERGER AND CHANGE OF NAME Recorded Mar 26, 2002
From: AQUILA BIOPHARMACEUTICALS, INC.
To: ANTIGENICS INC.
Reel/Frame 012992/0018 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Feb 7, 2000
From: KENSIL, CHARLOTTE A.
To: AQUILA BIOPHARMACEUTICALS, INC.
Reel/Frame 010610/0875 →
Continuity (2)
Provisional Application 6012860800 · Apr 8, 1999
Provisional Application 6009591300 · Aug 10, 1998