Identification of sortase gene
View Patent ↗The present invention is a substantially purified sortase-transamidase enzyme from Gram-positive bacteria, such as Staphylococcus aureus . The enzyme having a molecular weight of about 23,539 daltons and catalyzing a reaction that covalently cross-links the carboxyl terminus of a protein having a sorting signal to the peptidoglycan of a Gram-positive bacterium, the sorting signal having: (1) a motif of LPX 3 X 4 G (SEQ ID NO: 37) therein; (2) a substantially hydrophobic domain of at least 31 amino acids carboxyl to the motif; and (3) a charged tail region with at least two positively charged residues carboxyl to the substantially hydrophobic domain, at least one of the two positively charged residues being arginine, the two positively charged residues being located at residues 31-33 from the motif, wherein X 3 is any of the twenty naturally-occurring L-amino acids and X 4 is selected from the group consisting of alanine, serine, and threonine, and wherein sorting occurs by cleavage between the fourth and fifth residues of the LPX 3 X 4 G (SEQ ID NO: 37) motif. Variants of the enzyme, methods for cloning the gene encoding the enzyme and expressing the cloned gene, and methods of use of the enzyme, including for screening for antibiotics and for display of proteins or peptides on the surfaces of Gram-positive bacteria, are also disclosed.
1. A method for screening a compound for anti-sortase-transamidase activity comprising the steps of:
(a) providing a substantially purified sortase-transamidase enzyme produced by a process comprising the steps of:
(i) culturing a host cell transfected with a vector, said vector comprising a nucleic acid sequence encoding a sortase-transamidase enzyme from a Gram-positive bacterium, the enzyme catalyzing a reaction that covalently cross-links the carboxyl terminus of a protein having a sorting signal to the peptidoglycan of a Gram-positive bacterium, the sorting signal having a motif of LPX 3 X 4 G (SEQ ID NO: 37) therein, wherein sorting occurs by cleavage between the fourth and fifth residues of the LPX 3 X 4 G (SEQ ID NO: 37) motif, said sortase-transamidase enzyme including therein an amino acid sequence selected from the group consisting of: (1) M-K-K-W-T-N-R-L-M-T-I-A-G-V-V-L-I-L-V-A-A-Y-L-F-A-K-P-H-I-D-N-Y-L-H-D-K-D-K-D-E-K-I-E-Q-Y-D-K-N-V-K-E-Q-A-S-K-D-K-K-Q-Q-A-K-P-Q-I-P-K-D-K-S-K-V-A-G-Y-I-E-I-P-D-A-D-I-K-E-P-V-Y-P-G-P-A-T-P-E-Q-L-N-R-G-V-S-F-A-E-E-N-E-S-L-D-D-Q-N-I-S-I-A-G-H-T-F-I-D-R-P-N-Y-Q-F-T-N-L-K-A-A-K-K-G-S-M-V-Y-F-K-V-G-N-E-T-R-K-Y-K-M-T-S-I-R-D-V-K-P-T-D-V-G-V-L-D-E-Q-K-G-K-D-K-Q-L-T-L-I-T-C-D-D-Y-N-E-K-T-G-V-W-E-K-R-K-I-F-V-A-T-E-V-K (SEQ ID NO: 3); and (2) sequences incorporating one or more conservative amino acid substitutions in SEQ ID NO: 3, wherein the conservative amino acid substitutions are any of the following: (1) any of isoleucine, leucine, and valine for any other of these amino acids; (2) aspartic acid for glutamic acid and vice versa; (3) glutamine for asparagine and vice versa; and (4) serine for threonine, and vice versa;
said vector being operatively linked to at least one control sequence that controls the expression or regulation of the nucleic acid sequence,
said culturing comprising culturing said host cell under conditions in which the host cell expresses the encoded sortase-transamidase enzyme; and
(ii) purifying the expressed enzyme to produce substantially purified sortase-transamidase enzyme;
(b) performing an assay for sortase-transamidase in the presence and in the absence of the compound; and
(c) comparing the activity of the sortase-transamidase enzyme in the presence and in the absence of the compound to screen the compound for sortase-transamidase activity.
2. A method for screening a compound for anti-sortase-transamidase activity comprising the steps of:
(a) providing a substantially purified sortase-transamidase enzyme produced by a process comprising the steps of:
(i) culturing a host cell transfected with a vector comprising a nucleic acid sequence encoding a sortase-transamidase enzyme that includes therein the amino acid sequence M-K-K-W-T-N-R L-M-T-I-A-G-V-V-L-I-L-V-A-A-Y-L-F-A-K-P-H-I-D-N-Y-L-H-D-K-D-K-D-E-K-I-E-Q-Y-D-K-N-V-K-E- -K Q-A-S-K-D-K-Q-Q-A-K-P-Q-I-P-K-D-K-S-K-V-A-G-Y-I-E-I-P-D-A-D-I-K-E-P-V-Y-P-G-P-A-T-P-E-Q-L-N-R-G-V-S-F-A-E-E-N-E-S-L-D-D-Q-N-I-S-I-A-G-H-T-F-I-D-R-P-N-Y-Q-F-T-N-L-K-A-A-K-K-G-S-M-V-Y-F-K-V-G-N-E-T-R-K-Y-K-M-T-S-I-R-D-V-K-P-T-D-V-G-V-L-D-E-Q-K-G-K-D-K-Q-L-T-L-I-T-C-D-D-Y-N-E-K-T-G-V-W-E-K-R-K-I-F-V-A-T-E-V-K (SEQ ID NO: 3), said nucleic acid sequence being operatively linked to at least one control sequence that controls the expression or regulation of the nucleic acid sequence,
said culturing comprising culturing said host cell under conditions in which the host cell expresses the encoded sortase-transamidase enzyme; and
(ii) purifying the expressed enzyme to produce substantially purified sortase-transamidase enzyme;
(b) performing an assay for sortase-transamidase in the presence and in the absence of the compound, and
(c) comparing the activity of the sortase-transamidase enzyme in the presence and in the absence of the compound to screen the compound for sortase-transamidase activity.
3. A method for screening a compound for anti-sortase-transamidase activity comprising the steps of:
(a) providing a substantially purified sortase-transamidase enzyme produced by a process comprising the steps of:
(i) culturing a host cell transfected with a vector comprising a nucleic acid sequence encoding a sortase-transamidase enzyme from a Gram-positive bacterium, the enzyme having a molecular weight of about 23,539 daltons, wherein the nucleic acid sequence includes therein a sequence selected from the group consisting of:
ATGAAAAAATGGACAAATCGATTAATGACAATCGCTGGTGTGGTACTTATCC TAGTGGCAGCATATTTGITTGCTAAACCACATATCGATAATTATCTTCACGATAAAG ATAAAGATGAAAAGATTGAACAATATGATAAAAATGTAAAAGAACAGGCGAGTAAAG ATAAAAAGCAGCAAGCTAAACCTCAAATTCCGAAAGATAAATCGAAAGTGGCAGGC TATATTGAAATTCCAGATGCTGATATTAAAGAACCAGTATATCCAGGACCAGCAACA CCTGAACAATTAAATAGAGGTGTAAGGCTTTGCAGAAGAAAATGAATCACTAGATGAT CAAAATATTTCAATTGCAGGACACACTTTCATTGACCGTCCGAACTATCAATTTACA AATCTTAAAGCAGCCAAAAAAGGTAGTATGGTGTACTTTAAAGTTGGTAATGAAACA CGTAAGTATAAAATGACAAGTATAAGAGATGTTAAGCCTACAGATGTAGGAGTTCTA GATGAACAAAAAGGTAAAGATAAACAATTAACATTAATTACTTGTGATGATTACAAT GAAAAGACAGGCGTTTGGGAAAACGTAAAATCTTTGTAGCTACAGMGTCAAATA A (SEQ ID NO: 2); or (2) a sequence complementary to SEQ ID NO. 2,
said nucleic acid sequence being operatively linked to at least one control sequence that controls the expression or regulation of the nucleic acid sequence,
said culturing comprising culturing said host cell under conditions in which the host cell expresses the encoded sortase-transamidase enzyme; and
(ii) purifying the expressed enzyme to produce substantially purified sortase-transamidase enzyme;
(b) performing an assay for sortase-transamidase in the presence and in the absence of the compound; and
(c) comparing the activity of the sortase-transamidase enzyme in the presence and in the absence of the compound to screen the compound for sortase-transamidase activity.
4. A method for screening a compound for anti-sortase-transamidase activity comprising the steps of:
(a) providing a substantially purified sortase-transamidase enzyme produced by a process comprising the steps of:
(i) culturing a host cell transformed with a vector comprising a nucleic acid sequence encoding a sortase-transamidase enzyme from a Gram-positive bacterium, the enzyme catalyzing a reaction that covalently cross-links the carboxyl terminus of a protein having a sorting signal to the peptidoglycan of a Gram-positive bacterium, the sorting signal having a motif of LPX 3 X 4 G (SEQ ID NO: 37) therein, wherein sorting occurs by cleavage between the fourth and fifth residues of the LPX 3 X 4 G (SEQ ID NO: 37) motif, the enzyme having a molecular weight of about 23,539 daltons, wherein the nucleic acid sequence hybridizes with a sequence selected from the group consisting of: (1) ATGAAAAAATGGACAAATCGATTAATGACAATCGCTGGTGTGGTACTTATCCTAGT GGCAGCATATTTGTTTGCTAAACCACATATCGATAATTATCTTCACGATAAAGATAA AGATGAAAAGATTGAACAATATGATAAAAATGTAAAAGAACAGGCGAGTAAAGATAA AAAGCAGCAAGCTAAACCTCAAATTCCGAAAGATAAATCGAAAGTGGCAGGCTATA TTGAAATTCCAGATGCTGATATTAAAGAACCAGTATATCCAGGACCAGCAACACCT GAACAATTAAATAGAGGTGTAAGCTTTGCAGAAGAAAATGAATCACTAGATGATCAA AATATTTCAATTGCAGGACACACTTTCATTGACCGTCCGAACTATCAATTACAAAT CTTAAAGCAGCCAAAAAAGGTAGTATGGTGTACTTTAAAGTTGGTAATGAAACACG TAAGTATAAAATGACAAGTATAAGAGATGTTAAGCCTACAGATGTAGGAGTTCTAGA TGAACAAAAAGGTAAAGATAAACAATTAACATTAATTACTTGTGATGATTACAATGAA AAGACAGGCGTTTGGGAAAAACGTAAAATCTTTGTAGCTACAGAAGTCAAATAA (SEQ ID NO; 2) or (2) a sequence complementary to SEQ ID NO: 2, with no greater than about a 5% mismatch as determined by the inability of some bases to form Watson-Crick pairs when two nucleic acid sequences are hybridized with best alignment,
said nucleic acid sequence being operatively linked to at least one control sequence that controls the expression or regulation of the nucleic acid sequence,
said culturing comprising culturing said host cell under conditions in which the host cell expresses the encoded sortase-transamidase enzyme; and
(ii) purifying the expressed enzyme to produce substantially purified sortase-transamidase enzyme;
(b) performing an assay for sortase-transamidase in the presence and in the absence of the compound; and
(c) comparing the activity of the sortase-transamidase enzyme in the presence and in the absence of the compound to screen the compound for sortase-transamidase activity.