Methods for producing soluble membrane-spanning proteins
Methods for producing membrane-spanning polypeptides in high yields, with native conformation, and/or in soluble form include solubilizing in non-ionic or zwitterionic detergents, as well as use of promoters and expression vectors for expressing high yields of membrane-spanning polypeptides in bacterial cells. Mutated promoters provide tight control of membrane-spanning polypeptides in bacterial cell hosts.
1. An expression construct comprising:
a) a polynucleotide encoding a multiple-membrane-spanning CD20 polypeptide or a multiple-membrane-spanning fragment of said CD20 polypeptide;
b) a phac promoter operatively linked to the CD20 polypeptide-encoding polynucleotide; and
c) a polynucleotide encoding β-galactosidase translation initiation enhancer.
2. The expression construct of claim 1 , wherein the expression construct further comprises:
a) at least one positive regulatory control element comprising a pho box; or
b) a negative regulatory control element comprising a lac operator.
3. The expression construct of claim 2 , wherein the negative control element comprises a bacterial lac operator of an operator/repressor system.
4. The expression construct of claim 2 , wherein the negative control element comprises an E. coli lac operator.
5. The expression construct of claim 2 , wherein the expression construct comprises a positive control element comprising a pho box and a negative control element comprising a lac operator.
6. The expression construct of claim 2 , wherein the pho box positive control element comprises an E. coli pho box.
7. The expression construct of claim 1 , wherein the construct further comprises one or more transcriptional terminators positioned to prevent read-through from upstream promoters.
8. The expression construct of claim 7 , wherein the transcriptional terminator comprises a lambda sequence:
AACGCTCGGTTGCCGCCGGGCGTTTTTTATT (SEQ ID NO:17) or a His operon terminator.
9. The expression construct of claim 1 , wherein the promoter further comprises
at least one heterologous regulatory control element to reduce basal activity.
10. The expression construct of claim 9 , wherein the promoter expression is induced by exposure to phosphate-limiting media.
11. The expression construct of claim 1 , wherein the phac promoter comprises a nucleic acid sequence SEQ ID NO:15 (PHAC).
12. The expression construct of claim 1 , wherein the β-galactosidase translation initiation enhancer comprises about the first 6 to about 12 codons of a β-galactosidase gene.
13. The expression construct of claim 12 , wherein the translation initiation enhancer is positioned upstream of the nucleotide sequence encoding the CD20 polypeptide.
14. The expression construct of claim 1 , wherein the β-galactosidase translation initiation enhancer further comprises about the first 6 to about 12 codons of a Protein A or glutathione-S-transferase gene.
15. The expression construct of claim 1 , wherein the β-galactosidase translation initiation enhancer comprises a nucleotide sequence ATGGGCAGCAGCCATCATCATCATCATCAT (SEQ ID NO:34).
16. The expression construct of claim 1 , comprising a nucleotide sequence encoding an amino acid sequence MKHQHQQ (SEQ ID NO:7).
17. The expression construct of claim 1 , wherein the translation initiation enhancer sequence further comprises a polynucleotide sequence encoding a translation elongation spacer sequence.
18. The expression construct of claim 17 , wherein the polynucleotide sequence encoding the translation elongation spacer sequence comprises at least a portion of a gene that is known to be highly expressed in a bacterial cell.
19. The expression construct of claim 17 , wherein the polynucleotide sequence encoding the translation elongation spacer sequence comprises about 50 to about 120 codons of the highly expressed gene.
20. The expression construct of claim 17 , wherein the polynucleotide sequence encoding the translation elongation spacer sequence comprises about 50 to about 120 codons of the E gene of the trp operon.
21. The expression construct of claim 17 , wherein the polynucleotide sequence encoding the translation elongation spacer sequence encodes SEQ ID NO:29.
22. The expression construct of claim 1 ,wherein the CD20 membrane-spanning polypeptide has an amino acid sequence comprising at least 80% identity to SEQ ID NO: 1.
23. The expression construct of claim 22 , wherein the CD20 polypeptide has an amino acid substitution at a residue corresponding to Cys111 of SEQ ID NO:1, corresponding to Cys220 of SEQ ID NO:1, or corresponding to both Cys111 and Cys220 of SEQ ID NO:1.
24. The expression construct of claim 23 , wherein the CD20 polypeptide consists of an amino acid substitution at a residue corresponding to Cys111Ser of SEQ ID NO:1, corresponding to Cys220Ser of SEQ ID NO:1, or corresponding to both Cys111 and Cys220 of SEQ ID NO:1.
25. The expression construct of claim 22 , wherein the CD20 polypeptide has amino acid substitutions at residues corresponding to Cys81Ala, Cys111Ser, and Cys220Ser of SEQ ID NO: 1.
26. The expression construct of claim 22 , wherein the CD20 polypeptide-encoding polynucleotide comprises a sequence encoding amino acid sequence SEQ ID NO: 6.
27. The expression construct of claim 1 , wherein the fragment of CD20 comprises residues K116 through N214 of SEQ ID NO: 1.
28. The expression construct of claim 1 , further comprising a nucleic acid sequence encoding an expression tag.
29. The expression construct of claim 28 , wherein the expression tag comprises a poly His tag or HisGln tag.
30. The expression construct of claim 1 , wherein the expression construct further comprises one or more tRNA genes of a bacterial cell.
31. The expression construct of claim 30 , wherein the tRNA genes comprise argU, glyT, or pro2.
32. A bacterial cell comprising the expression construct of claim 1 .
33. The expression construct of claim 1 , wherein the expression construct is or comprises a vector or a plasmid.
34. The expression construct of claim 33 , wherein the vector is an expression vector or a cloning vector.
35. A polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 90% identity with SEQ ID NO:1, wherein one or more of residues corresponding to Cys81, Cys111, and Cys220 of SEQ ID NO:1 are substituted.