Method for determination of presence of crossing with cultivated rose in wild rose
Disclosed is a method for determining whether or not a wild rose of interest is crossed with a cultivated rose. The method comprises the steps of: examining whether or not a KSN gene containing a transposon (an indicator) is contained in the rose of interest; and determining that the rose of interest is crossed with a cultivated rose when the individual has the transposon-containing KSN gene.
1. A method of determining whether or not a wild rose of interest is crossed with a cultivated rose, which comprises
detecting whether a seed of the wild rose comprises a KSN gene containing an inserted indicator transposon; and
determining whether or not the wild rose is crossed with a cultivated rose, wherein the presence of the KSN gene containing the inserted indicator transposon in the seed of the wild rose indicates a crossing between the wild rose and the cultivated rose, and wherein the absence of the KSN gene containing the inserted indicator transposon in the seed of the wild rose indicates no crossing between the wild rose and the cultivated rose.
2. The method according to claim 1 , wherein the cultivated rose comprises a gene related to flower color, wherein the gene related to flower color is the gene of the flavonoid 3′,5′-hydroxylase enzyme derived from pansy of the family Violaceae.
3. The method according to claim 1 , wherein hybridization is carried out to detect whether the seed of the wild rose comprises the KSN gene containing the inserted indicator transposon.
4. The method according to claim 1 , wherein specific amplification by polymerase chain reaction (PCR) is carried out to detect whether the seed of the wild rose comprises the KSN gene containing the inserted indicator transposon.
5. The method according to claim 4 , wherein PCR is carried out via a forward primer: CATATTATGGCATAGGGTGTGGC (SEQ ID NO: 3) and a reverse primer: TGTAATCTGTAGGAGATCCCATGC (SEQ ID NO: 4).
6. The method according to claim 1 , wherein the wild rose has, in the homologous configuration, a KSN gene that does not contain the inserted indicator transposon.
7. The method according to claim 1 , wherein the wild rose is selected from the group consisting of NOIBARA ( R. multiflora Thunb. ex Murray), TERIHANOIBARA ( R. wichuraiana Crep.), HAMANASU ( R. rugosa Thunb. ex Murray), OOTAKANEBARA ( R. acicularis Lindl.), KARAFUTOIBARA ( R. marretii Lev.), OOFUJIIBARA, AZUMAIBARA, YAMATERIHANOIBARA ( R. luciae Franch. et Rochebr.), YAMAIBARA ( R. sambucina Koidz.), KAKAYANBARA, YAEYAMANOIBARA ( R. Bracteata Wendl.), NANIWAIBARA ( R. laevigata Michx.), SANSHOUBARA ( R. roxburghii Tratt. var. hirtula (Regel) Rehd. et Wils.), TAKANEBARA ( R. acicularis var. nipponensis (Crép.) Koehne.), TSUKUSHIIBARA ( R. multiflora var. adenochaeta (Koidz.) Makino), MORIIBARA ( R. luciae var. hakonensis Franch. et Say.), FUJIIBARA ( R. luciae var. fujisanensis Makino), YABUIBARA, NIOIIBARA ( R. luciae var. onoei (Makino) Momiyama), and MIYAKOIBARA ( R. luciae var. paniculgera (Makino) Momiyama).
8. The method according to claim 1 , wherein the cultivated rose has, in the homologous configuration, a KSN gene having the indicator transposon inserted therein.
9. The method according to claim 1 , wherein the cultivated rose is a hybrid tea, a floribunda, or a miniature.
10. The method of claim 4 , where PCR iscarried using a first primer capable of hybridizing with a region of the base sequence set forth in SEQ ID NO: 1 and a second primer capable of hybridizing with a region of the base sequence set forth in SEQ ID NO: 2.